Incidental Mutation 'R6336:Foxred2'
ID510778
Institutional Source Beutler Lab
Gene Symbol Foxred2
Ensembl Gene ENSMUSG00000016552
Gene NameFAD-dependent oxidoreductase domain containing 2
SynonymsD15Bwg0759e, A430097D04Rik, LOC239554
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R6336 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location77940522-77956722 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77955764 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 109 (Y109H)
Ref Sequence ENSEMBL: ENSMUSP00000016696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016696] [ENSMUST00000100484] [ENSMUST00000117725]
Predicted Effect probably damaging
Transcript: ENSMUST00000016696
AA Change: Y109H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000016696
Gene: ENSMUSG00000016552
AA Change: Y109H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pyr_redox_2 22 243 2.9e-11 PFAM
Pfam:Pyr_redox_3 25 240 9.3e-35 PFAM
Pfam:NAD_binding_8 26 84 3.3e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100484
SMART Domains Protein: ENSMUSP00000098053
Gene: ENSMUSG00000016554

DomainStartEndE-ValueType
Pfam:eIF-3_zeta 4 521 6.3e-220 PFAM
low complexity region 530 547 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117725
AA Change: Y109H

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113403
Gene: ENSMUSG00000016552
AA Change: Y109H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pyr_redox_2 23 478 3.4e-9 PFAM
Pfam:Pyr_redox_3 25 240 6.2e-37 PFAM
Pfam:NAD_binding_8 26 90 4.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229824
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,183,483 P955Q possibly damaging Het
Adgrv1 T C 13: 81,385,981 N5827S probably benign Het
Akt3 T C 1: 177,031,712 D431G probably damaging Het
Anapc16 A T 10: 59,988,829 V76D possibly damaging Het
Ankib1 A T 5: 3,700,377 Y755* probably null Het
Ankrd6 A G 4: 32,860,411 S11P probably damaging Het
Card6 T A 15: 5,099,164 K917* probably null Het
Ccdc152 T C 15: 3,301,129 I21M probably damaging Het
Ccdc40 A G 11: 119,231,993 E207G possibly damaging Het
Clca3a2 G T 3: 144,806,478 A499E probably benign Het
Cntnap5b C T 1: 100,358,669 A383V probably benign Het
Ddo T C 10: 40,633,031 V89A probably damaging Het
Depdc5 T C 5: 32,964,507 probably null Het
Dlgap1 T A 17: 70,815,289 D904E probably damaging Het
Ephb4 T A 5: 137,372,085 L849H probably damaging Het
Fbxl13 A G 5: 21,523,547 probably null Het
Fer1l6 C A 15: 58,559,232 Y245* probably null Het
Gabarapl1 A G 6: 129,537,528 D43G probably benign Het
Gabrb1 A C 5: 72,029,898 E178A possibly damaging Het
Gbp11 A G 5: 105,325,489 Het
Gm31371 A G 8: 19,924,350 K242E unknown Het
Grin3b C A 10: 79,976,461 A845E probably damaging Het
Hoxd4 A G 2: 74,727,361 Y28C probably damaging Het
Igsf10 G A 3: 59,330,339 T807M probably benign Het
Kcnt1 A G 2: 25,888,755 probably null Het
Kdm5a C A 6: 120,398,978 T565K probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Mok A G 12: 110,834,124 probably null Het
Mto1 A T 9: 78,473,835 I73F probably damaging Het
Mtss1l G A 8: 110,732,164 D310N probably damaging Het
Ncf2 T C 1: 152,834,070 Y393H probably damaging Het
Olfr1299 A G 2: 111,664,619 H131R possibly damaging Het
Olfr1317 A C 2: 112,142,406 I154L probably benign Het
Olfr1384 G T 11: 49,514,542 K301N probably damaging Het
Olfr272 A T 4: 52,911,459 C112S probably damaging Het
Olfr38 T C 6: 42,762,657 S202P probably damaging Het
Olfr67 T C 7: 103,788,245 T11A possibly damaging Het
Phxr2 T A 10: 99,126,090 probably benign Het
Rnf17 A G 14: 56,421,169 probably null Het
Serpinb9d T C 13: 33,194,694 M41T probably damaging Het
Slc12a5 T A 2: 164,992,464 probably null Het
Slc22a6 G A 19: 8,622,130 R331H probably benign Het
Spg11 G C 2: 122,112,959 probably null Het
Src T A 2: 157,457,155 V24E probably benign Het
Srgap1 A T 10: 121,925,941 Y101N probably benign Het
Vmn2r30 T A 7: 7,334,308 T110S probably benign Het
Vwa3a A G 7: 120,762,423 E119G possibly damaging Het
Whamm T A 7: 81,591,764 D274E probably damaging Het
Other mutations in Foxred2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Foxred2 APN 15 77955620 missense probably benign 0.30
IGL01479:Foxred2 APN 15 77952289 splice site probably null
IGL01748:Foxred2 APN 15 77952346 missense probably damaging 1.00
IGL02160:Foxred2 APN 15 77955650 missense probably benign 0.03
IGL02328:Foxred2 APN 15 77955832 missense probably damaging 1.00
IGL02630:Foxred2 APN 15 77947162 missense probably benign 0.05
IGL02672:Foxred2 APN 15 77945577 critical splice donor site probably null
soma UTSW 15 77953358 missense possibly damaging 0.78
R0271:Foxred2 UTSW 15 77943390 missense possibly damaging 0.68
R1386:Foxred2 UTSW 15 77948521 critical splice acceptor site probably null
R1581:Foxred2 UTSW 15 77955761 missense possibly damaging 0.94
R4399:Foxred2 UTSW 15 77953358 missense possibly damaging 0.78
R4399:Foxred2 UTSW 15 77955680 missense probably benign 0.06
R4528:Foxred2 UTSW 15 77943249 missense probably benign 0.01
R4937:Foxred2 UTSW 15 77955835 missense probably damaging 1.00
R5165:Foxred2 UTSW 15 77956012 missense probably damaging 1.00
R5318:Foxred2 UTSW 15 77952398 missense probably benign 0.00
R5893:Foxred2 UTSW 15 77947144 missense probably damaging 1.00
R6370:Foxred2 UTSW 15 77943306 missense probably benign 0.01
R6426:Foxred2 UTSW 15 77953308 missense probably damaging 1.00
R6826:Foxred2 UTSW 15 77947085 missense probably benign 0.01
R6891:Foxred2 UTSW 15 77955709 missense probably damaging 1.00
R6934:Foxred2 UTSW 15 77952330 nonsense probably null
Z1088:Foxred2 UTSW 15 77952003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAATCTCGAGGCCAATTCG -3'
(R):5'- GCAGGGACTACGAGGTATTC -3'

Sequencing Primer
(F):5'- CCAATTCGGCTGTGTCCTGAG -3'
(R):5'- CAGGGACTACGAGGTATTCGAACG -3'
Posted On2018-04-02