Incidental Mutation 'R6328:Nudt5'
ID510788
Institutional Source Beutler Lab
Gene Symbol Nudt5
Ensembl Gene ENSMUSG00000025817
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6328 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location5845019-5871895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5864437 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Isoleucine at position 158 (K158I)
Ref Sequence ENSEMBL: ENSMUSP00000117670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026927] [ENSMUST00000071016] [ENSMUST00000127116] [ENSMUST00000179748] [ENSMUST00000194933]
Predicted Effect probably benign
Transcript: ENSMUST00000026927
AA Change: K158I

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026927
Gene: ENSMUSG00000025817
AA Change: K158I

DomainStartEndE-ValueType
Pfam:NUDIX 57 191 1.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071016
SMART Domains Protein: ENSMUSP00000063314
Gene: ENSMUSG00000056718

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000127116
AA Change: K158I

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117670
Gene: ENSMUSG00000025817
AA Change: K158I

DomainStartEndE-ValueType
Pfam:NUDIX 57 158 3.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142918
Predicted Effect probably benign
Transcript: ENSMUST00000179748
AA Change: K158I

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136233
Gene: ENSMUSG00000025817
AA Change: K158I

DomainStartEndE-ValueType
Pfam:NUDIX 57 192 1.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194933
SMART Domains Protein: ENSMUSP00000141265
Gene: ENSMUSG00000025817

DomainStartEndE-ValueType
PDB:3BM4|B 1 88 4e-44 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the Nudix (nucleoside diphosphate linked moiety X) hydrolase superfamily. The encoded enzyme catalyzes the hydrolysis of modified nucleoside diphosphates, including ADP-ribose (ADPR) and 8-oxoGua-containing 8-oxo-dADP and 8-oxo-dGDP. Protein-bound ADP ribose can be hazardous to the cell because it can modify some amino acid residues, resulting in the inhibition of ATP-activated potassium channels. 8-oxoGua is an oxidized form of guanine that can potentially alter genetic information by pairing with adenine and cytosine in RNA. Presence of 8-oxoGua in RNA results in formation of abnormal proteins due to translational errors. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Abcb10 G A 8: 123,962,017 R507W probably damaging Het
Actg1 T C 11: 120,347,760 D80G possibly damaging Het
Actr5 A G 2: 158,635,344 D405G possibly damaging Het
Ahnak C T 19: 9,007,148 T1932I probably benign Het
Ankk1 T A 9: 49,416,071 T603S possibly damaging Het
Atp13a3 A T 16: 30,336,235 F964I probably damaging Het
Atp6v1g3 A G 1: 138,287,832 T77A probably benign Het
Bccip A G 7: 133,717,774 H198R probably damaging Het
Bsx A T 9: 40,874,223 R16W probably damaging Het
Ccdc88b C T 19: 6,849,038 R1103Q probably damaging Het
Cd59a A C 2: 104,110,758 Y27S probably damaging Het
Cdk20 A G 13: 64,436,599 H162R probably damaging Het
Col6a2 C T 10: 76,614,378 E240K possibly damaging Het
Ddr2 A G 1: 169,987,065 V603A possibly damaging Het
Dgkz A G 2: 91,942,635 V359A probably benign Het
Dis3l2 T A 1: 86,854,431 S223T probably benign Het
Dpysl4 A G 7: 139,099,818 S535G probably benign Het
Dsp A T 13: 38,197,006 K1977* probably null Het
Dync2h1 A T 9: 7,165,717 S515T probably benign Het
Epg5 A G 18: 78,028,964 E2397G possibly damaging Het
Fam83d G A 2: 158,785,176 G262S probably damaging Het
Frmd4a A T 2: 4,590,698 T477S probably damaging Het
Gbp3 A G 3: 142,569,058 E382G probably benign Het
Gltp A T 5: 114,670,511 C157S possibly damaging Het
Grb10 A G 11: 11,937,905 S378P probably damaging Het
Gulo G T 14: 66,002,631 T126K probably damaging Het
H2-M10.6 T A 17: 36,813,944 M251K probably damaging Het
Hecw1 T C 13: 14,247,620 D967G possibly damaging Het
Htr3b A T 9: 48,947,633 D68E probably damaging Het
Igkv5-39 G T 6: 69,900,505 S89* probably null Het
Kctd4 C A 14: 75,962,597 probably benign Het
Lmna T C 3: 88,486,506 Q255R probably damaging Het
Lsmem1 A G 12: 40,180,657 I82T possibly damaging Het
Lyg2 T A 1: 37,911,113 M45L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Nufip1 C T 14: 76,111,054 P41L possibly damaging Het
Olfr1307 A T 2: 111,945,394 W21R probably null Het
Olfr618 A T 7: 103,597,866 E183D probably damaging Het
Pcp2 T C 8: 3,624,887 D22G probably damaging Het
Pdk2 G C 11: 95,039,402 N69K possibly damaging Het
Pdlim7 G T 13: 55,508,092 probably benign Het
Ptprc C A 1: 138,113,678 E148* probably null Het
Rassf5 A T 1: 131,180,668 V225E probably damaging Het
Rbm6 A T 9: 107,787,259 M725K probably benign Het
Scn1a T A 2: 66,273,316 I1867F probably damaging Het
Sdk2 T A 11: 113,793,755 Q1960L probably damaging Het
Setx A G 2: 29,174,462 probably benign Het
Sgo2b T A 8: 63,928,311 R496* probably null Het
Slco1a1 C T 6: 141,932,450 V222I probably damaging Het
Sntg2 A C 12: 30,258,014 L224R probably damaging Het
Syt16 C A 12: 74,266,693 C464* probably null Het
Tapbpl T A 6: 125,224,918 S420C probably benign Het
Tax1bp1 A G 6: 52,746,709 E528G probably benign Het
Tmem168 T C 6: 13,602,711 T219A probably benign Het
Zfp180 T C 7: 24,105,556 F467L probably damaging Het
Other mutations in Nudt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Nudt5 APN 2 5866357 missense probably damaging 1.00
IGL01085:Nudt5 APN 2 5864427 missense probably benign 0.01
IGL02683:Nudt5 APN 2 5863601 missense probably damaging 0.97
R0158:Nudt5 UTSW 2 5862303 missense probably damaging 1.00
R1193:Nudt5 UTSW 2 5863600 missense probably benign 0.40
R2202:Nudt5 UTSW 2 5855983 missense possibly damaging 0.93
R2203:Nudt5 UTSW 2 5855983 missense possibly damaging 0.93
R2204:Nudt5 UTSW 2 5855983 missense possibly damaging 0.93
R2205:Nudt5 UTSW 2 5855983 missense possibly damaging 0.93
R3836:Nudt5 UTSW 2 5866347 splice site probably null
R4652:Nudt5 UTSW 2 5856065 intron probably benign
R4841:Nudt5 UTSW 2 5864428 missense probably benign 0.00
R4842:Nudt5 UTSW 2 5864428 missense probably benign 0.00
R5071:Nudt5 UTSW 2 5864387 missense probably benign 0.37
R5073:Nudt5 UTSW 2 5864387 missense probably benign 0.37
R5074:Nudt5 UTSW 2 5864387 missense probably benign 0.37
R5106:Nudt5 UTSW 2 5854829 utr 5 prime probably benign
R7530:Nudt5 UTSW 2 5864368 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATGTTGAATGAGCCCTGG -3'
(R):5'- GCTCACATTATTAAGTGGGGATC -3'

Sequencing Primer
(F):5'- GGCTCCACCCCTTCCAG -3'
(R):5'- AGATCTCTGCGTTCAAGGC -3'
Posted On2018-04-02