Incidental Mutation 'R6328:Slco1a1'
ID510804
Institutional Source Beutler Lab
Gene Symbol Slco1a1
Ensembl Gene ENSMUSG00000041698
Gene Namesolute carrier organic anion transporter family, member 1a1
SynonymsOatp1, Slc21a1, Oatp1a1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R6328 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location141907282-141946962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 141932450 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 222 (V222I)
Ref Sequence ENSEMBL: ENSMUSP00000132386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042119] [ENSMUST00000168119]
Predicted Effect probably damaging
Transcript: ENSMUST00000042119
AA Change: V222I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037022
Gene: ENSMUSG00000041698
AA Change: V222I

DomainStartEndE-ValueType
Pfam:OATP 21 597 6e-168 PFAM
Pfam:MFS_1 22 410 4.7e-28 PFAM
Pfam:Kazal_2 445 486 1.2e-10 PFAM
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168119
AA Change: V222I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132386
Gene: ENSMUSG00000041698
AA Change: V222I

DomainStartEndE-ValueType
Pfam:OATP 21 597 1.6e-168 PFAM
Pfam:MFS_1 22 410 1e-27 PFAM
Pfam:Kazal_2 445 486 4.6e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171651
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired organic anion transporter activity and urinary metabolomic profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Abcb10 G A 8: 123,962,017 R507W probably damaging Het
Actg1 T C 11: 120,347,760 D80G possibly damaging Het
Actr5 A G 2: 158,635,344 D405G possibly damaging Het
Ahnak C T 19: 9,007,148 T1932I probably benign Het
Ankk1 T A 9: 49,416,071 T603S possibly damaging Het
Atp13a3 A T 16: 30,336,235 F964I probably damaging Het
Atp6v1g3 A G 1: 138,287,832 T77A probably benign Het
Bccip A G 7: 133,717,774 H198R probably damaging Het
Bsx A T 9: 40,874,223 R16W probably damaging Het
Ccdc88b C T 19: 6,849,038 R1103Q probably damaging Het
Cd59a A C 2: 104,110,758 Y27S probably damaging Het
Cdk20 A G 13: 64,436,599 H162R probably damaging Het
Col6a2 C T 10: 76,614,378 E240K possibly damaging Het
Ddr2 A G 1: 169,987,065 V603A possibly damaging Het
Dgkz A G 2: 91,942,635 V359A probably benign Het
Dis3l2 T A 1: 86,854,431 S223T probably benign Het
Dpysl4 A G 7: 139,099,818 S535G probably benign Het
Dsp A T 13: 38,197,006 K1977* probably null Het
Dync2h1 A T 9: 7,165,717 S515T probably benign Het
Epg5 A G 18: 78,028,964 E2397G possibly damaging Het
Fam83d G A 2: 158,785,176 G262S probably damaging Het
Frmd4a A T 2: 4,590,698 T477S probably damaging Het
Gbp3 A G 3: 142,569,058 E382G probably benign Het
Gltp A T 5: 114,670,511 C157S possibly damaging Het
Grb10 A G 11: 11,937,905 S378P probably damaging Het
Gulo G T 14: 66,002,631 T126K probably damaging Het
H2-M10.6 T A 17: 36,813,944 M251K probably damaging Het
Hecw1 T C 13: 14,247,620 D967G possibly damaging Het
Htr3b A T 9: 48,947,633 D68E probably damaging Het
Igkv5-39 G T 6: 69,900,505 S89* probably null Het
Kctd4 C A 14: 75,962,597 probably benign Het
Lmna T C 3: 88,486,506 Q255R probably damaging Het
Lsmem1 A G 12: 40,180,657 I82T possibly damaging Het
Lyg2 T A 1: 37,911,113 M45L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Nudt5 A T 2: 5,864,437 K158I possibly damaging Het
Nufip1 C T 14: 76,111,054 P41L possibly damaging Het
Olfr1307 A T 2: 111,945,394 W21R probably null Het
Olfr618 A T 7: 103,597,866 E183D probably damaging Het
Pcp2 T C 8: 3,624,887 D22G probably damaging Het
Pdk2 G C 11: 95,039,402 N69K possibly damaging Het
Pdlim7 G T 13: 55,508,092 probably benign Het
Ptprc C A 1: 138,113,678 E148* probably null Het
Rassf5 A T 1: 131,180,668 V225E probably damaging Het
Rbm6 A T 9: 107,787,259 M725K probably benign Het
Scn1a T A 2: 66,273,316 I1867F probably damaging Het
Sdk2 T A 11: 113,793,755 Q1960L probably damaging Het
Setx A G 2: 29,174,462 probably benign Het
Sgo2b T A 8: 63,928,311 R496* probably null Het
Sntg2 A C 12: 30,258,014 L224R probably damaging Het
Syt16 C A 12: 74,266,693 C464* probably null Het
Tapbpl T A 6: 125,224,918 S420C probably benign Het
Tax1bp1 A G 6: 52,746,709 E528G probably benign Het
Tmem168 T C 6: 13,602,711 T219A probably benign Het
Zfp180 T C 7: 24,105,556 F467L probably damaging Het
Other mutations in Slco1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Slco1a1 APN 6 141909125 missense probably damaging 0.98
IGL00942:Slco1a1 APN 6 141946628 missense probably benign 0.00
IGL01301:Slco1a1 APN 6 141932530 splice site probably benign
IGL01306:Slco1a1 APN 6 141946587 nonsense probably null
IGL01774:Slco1a1 APN 6 141925613 nonsense probably null
IGL02097:Slco1a1 APN 6 141940039 missense possibly damaging 0.94
IGL02183:Slco1a1 APN 6 141921943 splice site probably benign
IGL02376:Slco1a1 APN 6 141924334 critical splice donor site probably null
IGL02550:Slco1a1 APN 6 141943465 missense probably benign 0.24
IGL02559:Slco1a1 APN 6 141921788 missense probably benign 0.01
IGL02825:Slco1a1 APN 6 141918617 missense probably damaging 1.00
IGL03352:Slco1a1 APN 6 141911885 missense probably benign 0.00
ANU23:Slco1a1 UTSW 6 141946587 nonsense probably null
R0041:Slco1a1 UTSW 6 141918459 splice site probably benign
R0153:Slco1a1 UTSW 6 141910701 splice site probably benign
R0610:Slco1a1 UTSW 6 141918461 critical splice donor site probably null
R0646:Slco1a1 UTSW 6 141925754 splice site probably benign
R0828:Slco1a1 UTSW 6 141921839 missense possibly damaging 0.89
R1674:Slco1a1 UTSW 6 141935935 missense probably damaging 0.99
R1848:Slco1a1 UTSW 6 141923111 missense probably benign 0.29
R3834:Slco1a1 UTSW 6 141943437 missense possibly damaging 0.94
R3953:Slco1a1 UTSW 6 141923107 missense probably damaging 1.00
R3974:Slco1a1 UTSW 6 141909093 missense probably benign 0.01
R4081:Slco1a1 UTSW 6 141935962 missense probably damaging 0.99
R4729:Slco1a1 UTSW 6 141908969 missense probably benign 0.00
R4752:Slco1a1 UTSW 6 141946614 missense possibly damaging 0.80
R4806:Slco1a1 UTSW 6 141909009 missense possibly damaging 0.76
R4812:Slco1a1 UTSW 6 141918593 missense probably damaging 1.00
R4963:Slco1a1 UTSW 6 141923099 missense probably benign 0.26
R5641:Slco1a1 UTSW 6 141939969 missense probably damaging 1.00
R6044:Slco1a1 UTSW 6 141940017 missense probably benign 0.01
R6211:Slco1a1 UTSW 6 141909049 missense probably benign 0.20
R6225:Slco1a1 UTSW 6 141924489 missense possibly damaging 0.70
R6428:Slco1a1 UTSW 6 141925690 missense probably damaging 1.00
R6787:Slco1a1 UTSW 6 141936487 missense probably benign 0.00
R7182:Slco1a1 UTSW 6 141911839 missense probably damaging 1.00
R7305:Slco1a1 UTSW 6 141924497 missense probably damaging 1.00
R7328:Slco1a1 UTSW 6 141936408 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTTGACAAATTCTAGAGGCTGATC -3'
(R):5'- GTAGAGCTCTTGTCTACCCTATTG -3'

Sequencing Primer
(F):5'- CCAGGTGCAGAAAATTCATCCTGG -3'
(R):5'- GTCTACCCTATTGCATTTTATCTGC -3'
Posted On2018-04-02