Incidental Mutation 'R6328:Actg1'
ID510821
Institutional Source Beutler Lab
Gene Symbol Actg1
Ensembl Gene ENSMUSG00000062825
Gene Nameactin, gamma, cytoplasmic 1
SynonymsActl, E51
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6328 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location120345690-120348542 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120347760 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 80 (D80G)
Ref Sequence ENSEMBL: ENSMUSP00000134070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062147] [ENSMUST00000071555] [ENSMUST00000089616] [ENSMUST00000106215] [ENSMUST00000128055] [ENSMUST00000131103]
Predicted Effect probably benign
Transcript: ENSMUST00000062147
SMART Domains Protein: ENSMUSP00000101821
Gene: ENSMUSG00000062825

DomainStartEndE-ValueType
ACTIN 5 153 1.43e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000071555
AA Change: D80G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071486
Gene: ENSMUSG00000062825
AA Change: D80G

DomainStartEndE-ValueType
ACTIN 5 375 2.96e-244 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089616
SMART Domains Protein: ENSMUSP00000087043
Gene: ENSMUSG00000062825

DomainStartEndE-ValueType
Pfam:Actin 1 84 3.8e-32 PFAM
Pfam:Actin 78 105 1.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106215
AA Change: D80G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101822
Gene: ENSMUSG00000062825
AA Change: D80G

DomainStartEndE-ValueType
ACTIN 5 375 2.96e-244 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128055
AA Change: D137G

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134296
Gene: ENSMUSG00000062825
AA Change: D137G

DomainStartEndE-ValueType
ACTIN 62 268 6.73e-61 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131103
AA Change: D80G

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134070
Gene: ENSMUSG00000062825
AA Change: D80G

DomainStartEndE-ValueType
Pfam:Actin 2 124 1.1e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183615
Meta Mutation Damage Score 0.278 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Actins are highly conserved proteins that are involved in various types of cell motility and maintenance of the cytoskeleton. In vertebrates, three main groups of actin isoforms, alpha, beta, and gamma, have been identified. The alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton, and as mediators of internal cell motility. Actin, gamma 1, encoded by this gene, is a cytoplasmic actin found in non-muscle cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice in which this gene has been conditionally disrupted in muscle tissue display a reduced mobility and classical hind limb contractures when suspended by the tail. Mice homozygous for a null allele exhibit prenatal lethality, premature death, and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Abcb10 G A 8: 123,962,017 R507W probably damaging Het
Actr5 A G 2: 158,635,344 D405G possibly damaging Het
Ahnak C T 19: 9,007,148 T1932I probably benign Het
Ankk1 T A 9: 49,416,071 T603S possibly damaging Het
Atp13a3 A T 16: 30,336,235 F964I probably damaging Het
Atp6v1g3 A G 1: 138,287,832 T77A probably benign Het
Bccip A G 7: 133,717,774 H198R probably damaging Het
Bsx A T 9: 40,874,223 R16W probably damaging Het
Ccdc88b C T 19: 6,849,038 R1103Q probably damaging Het
Cd59a A C 2: 104,110,758 Y27S probably damaging Het
Cdk20 A G 13: 64,436,599 H162R probably damaging Het
Col6a2 C T 10: 76,614,378 E240K possibly damaging Het
Ddr2 A G 1: 169,987,065 V603A possibly damaging Het
Dgkz A G 2: 91,942,635 V359A probably benign Het
Dis3l2 T A 1: 86,854,431 S223T probably benign Het
Dpysl4 A G 7: 139,099,818 S535G probably benign Het
Dsp A T 13: 38,197,006 K1977* probably null Het
Dync2h1 A T 9: 7,165,717 S515T probably benign Het
Epg5 A G 18: 78,028,964 E2397G possibly damaging Het
Fam83d G A 2: 158,785,176 G262S probably damaging Het
Frmd4a A T 2: 4,590,698 T477S probably damaging Het
Gbp3 A G 3: 142,569,058 E382G probably benign Het
Gltp A T 5: 114,670,511 C157S possibly damaging Het
Grb10 A G 11: 11,937,905 S378P probably damaging Het
Gulo G T 14: 66,002,631 T126K probably damaging Het
H2-M10.6 T A 17: 36,813,944 M251K probably damaging Het
Hecw1 T C 13: 14,247,620 D967G possibly damaging Het
Htr3b A T 9: 48,947,633 D68E probably damaging Het
Igkv5-39 G T 6: 69,900,505 S89* probably null Het
Kctd4 C A 14: 75,962,597 probably benign Het
Lmna T C 3: 88,486,506 Q255R probably damaging Het
Lsmem1 A G 12: 40,180,657 I82T possibly damaging Het
Lyg2 T A 1: 37,911,113 M45L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Nudt5 A T 2: 5,864,437 K158I possibly damaging Het
Nufip1 C T 14: 76,111,054 P41L possibly damaging Het
Olfr1307 A T 2: 111,945,394 W21R probably null Het
Olfr618 A T 7: 103,597,866 E183D probably damaging Het
Pcp2 T C 8: 3,624,887 D22G probably damaging Het
Pdk2 G C 11: 95,039,402 N69K possibly damaging Het
Pdlim7 G T 13: 55,508,092 probably benign Het
Ptprc C A 1: 138,113,678 E148* probably null Het
Rassf5 A T 1: 131,180,668 V225E probably damaging Het
Rbm6 A T 9: 107,787,259 M725K probably benign Het
Scn1a T A 2: 66,273,316 I1867F probably damaging Het
Sdk2 T A 11: 113,793,755 Q1960L probably damaging Het
Setx A G 2: 29,174,462 probably benign Het
Sgo2b T A 8: 63,928,311 R496* probably null Het
Slco1a1 C T 6: 141,932,450 V222I probably damaging Het
Sntg2 A C 12: 30,258,014 L224R probably damaging Het
Syt16 C A 12: 74,266,693 C464* probably null Het
Tapbpl T A 6: 125,224,918 S420C probably benign Het
Tax1bp1 A G 6: 52,746,709 E528G probably benign Het
Tmem168 T C 6: 13,602,711 T219A probably benign Het
Zfp180 T C 7: 24,105,556 F467L probably damaging Het
Other mutations in Actg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0731:Actg1 UTSW 11 120346949 missense probably damaging 1.00
R2015:Actg1 UTSW 11 120346810 missense possibly damaging 0.95
R2860:Actg1 UTSW 11 120346801 missense probably benign 0.03
R2861:Actg1 UTSW 11 120346801 missense probably benign 0.03
R2862:Actg1 UTSW 11 120346801 missense probably benign 0.03
R4473:Actg1 UTSW 11 120348259 missense probably benign 0.01
R4732:Actg1 UTSW 11 120347479 splice site probably benign
R5004:Actg1 UTSW 11 120348160 intron probably benign
R5026:Actg1 UTSW 11 120346958 missense probably damaging 1.00
R5060:Actg1 UTSW 11 120347013 missense probably benign 0.10
R5216:Actg1 UTSW 11 120347754 missense probably damaging 0.98
R6660:Actg1 UTSW 11 120346755 missense probably damaging 1.00
R6888:Actg1 UTSW 11 120347315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGACTCGTCACGCCCAAG -3'
(R):5'- TGTTCCCTTCCATCGTAGGG -3'

Sequencing Primer
(F):5'- CCAAGGGGAGGCAAGGTCC -3'
(R):5'- CCGACACCAGGTTAGTTGAG -3'
Posted On2018-04-02