Incidental Mutation 'R6328:Abat'
ID510832
Institutional Source Beutler Lab
Gene Symbol Abat
Ensembl Gene ENSMUSG00000057880
Gene Name4-aminobutyrate aminotransferase
SynonymsGABA-T, 9630038C02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6328 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location8513429-8621568 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 8602436 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065987] [ENSMUST00000115838] [ENSMUST00000115839] [ENSMUST00000138987]
Predicted Effect probably benign
Transcript: ENSMUST00000065987
SMART Domains Protein: ENSMUSP00000063548
Gene: ENSMUSG00000057880

DomainStartEndE-ValueType
Pfam:Aminotran_3 65 496 1.7e-136 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000115838
AA Change: H200Y
SMART Domains Protein: ENSMUSP00000111504
Gene: ENSMUSG00000057880
AA Change: H200Y

DomainStartEndE-ValueType
Pfam:Aminotran_3 76 186 5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115839
SMART Domains Protein: ENSMUSP00000111505
Gene: ENSMUSG00000057880

DomainStartEndE-ValueType
Pfam:Aminotran_3 76 323 3.2e-64 PFAM
Pfam:Aminotran_3 317 390 1.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138987
SMART Domains Protein: ENSMUSP00000116686
Gene: ENSMUSG00000057880

DomainStartEndE-ValueType
Pfam:Aminotran_3 53 232 1.9e-32 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000144444
AA Change: H104Y
SMART Domains Protein: ENSMUSP00000121881
Gene: ENSMUSG00000057880
AA Change: H104Y

DomainStartEndE-ValueType
Pfam:Aminotran_3 3 93 1.3e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: The encoded gene product is responsible for catabolism of gamma-aminobutyric acid (GABA), a mostly inhibitory neurotransmitter in the central nervous system, into succinic semialdehyde. Deficiency of this encoded protein includes psychomotor retardation, hypotonia, hyperreflexia, lethargy, refractory seizures, and EEG abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 G A 8: 123,962,017 R507W probably damaging Het
Actg1 T C 11: 120,347,760 D80G possibly damaging Het
Actr5 A G 2: 158,635,344 D405G possibly damaging Het
Ahnak C T 19: 9,007,148 T1932I probably benign Het
Ankk1 T A 9: 49,416,071 T603S possibly damaging Het
Atp13a3 A T 16: 30,336,235 F964I probably damaging Het
Atp6v1g3 A G 1: 138,287,832 T77A probably benign Het
Bccip A G 7: 133,717,774 H198R probably damaging Het
Bsx A T 9: 40,874,223 R16W probably damaging Het
Ccdc88b C T 19: 6,849,038 R1103Q probably damaging Het
Cd59a A C 2: 104,110,758 Y27S probably damaging Het
Cdk20 A G 13: 64,436,599 H162R probably damaging Het
Col6a2 C T 10: 76,614,378 E240K possibly damaging Het
Ddr2 A G 1: 169,987,065 V603A possibly damaging Het
Dgkz A G 2: 91,942,635 V359A probably benign Het
Dis3l2 T A 1: 86,854,431 S223T probably benign Het
Dpysl4 A G 7: 139,099,818 S535G probably benign Het
Dsp A T 13: 38,197,006 K1977* probably null Het
Dync2h1 A T 9: 7,165,717 S515T probably benign Het
Epg5 A G 18: 78,028,964 E2397G possibly damaging Het
Fam83d G A 2: 158,785,176 G262S probably damaging Het
Frmd4a A T 2: 4,590,698 T477S probably damaging Het
Gbp3 A G 3: 142,569,058 E382G probably benign Het
Gltp A T 5: 114,670,511 C157S possibly damaging Het
Grb10 A G 11: 11,937,905 S378P probably damaging Het
Gulo G T 14: 66,002,631 T126K probably damaging Het
H2-M10.6 T A 17: 36,813,944 M251K probably damaging Het
Hecw1 T C 13: 14,247,620 D967G possibly damaging Het
Htr3b A T 9: 48,947,633 D68E probably damaging Het
Igkv5-39 G T 6: 69,900,505 S89* probably null Het
Kctd4 C A 14: 75,962,597 probably benign Het
Lmna T C 3: 88,486,506 Q255R probably damaging Het
Lsmem1 A G 12: 40,180,657 I82T possibly damaging Het
Lyg2 T A 1: 37,911,113 M45L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Nudt5 A T 2: 5,864,437 K158I possibly damaging Het
Nufip1 C T 14: 76,111,054 P41L possibly damaging Het
Olfr1307 A T 2: 111,945,394 W21R probably null Het
Olfr618 A T 7: 103,597,866 E183D probably damaging Het
Pcp2 T C 8: 3,624,887 D22G probably damaging Het
Pdk2 G C 11: 95,039,402 N69K possibly damaging Het
Pdlim7 G T 13: 55,508,092 probably benign Het
Ptprc C A 1: 138,113,678 E148* probably null Het
Rassf5 A T 1: 131,180,668 V225E probably damaging Het
Rbm6 A T 9: 107,787,259 M725K probably benign Het
Scn1a T A 2: 66,273,316 I1867F probably damaging Het
Sdk2 T A 11: 113,793,755 Q1960L probably damaging Het
Setx A G 2: 29,174,462 probably benign Het
Sgo2b T A 8: 63,928,311 R496* probably null Het
Slco1a1 C T 6: 141,932,450 V222I probably damaging Het
Sntg2 A C 12: 30,258,014 L224R probably damaging Het
Syt16 C A 12: 74,266,693 C464* probably null Het
Tapbpl T A 6: 125,224,918 S420C probably benign Het
Tax1bp1 A G 6: 52,746,709 E528G probably benign Het
Tmem168 T C 6: 13,602,711 T219A probably benign Het
Zfp180 T C 7: 24,105,556 F467L probably damaging Het
Other mutations in Abat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Abat APN 16 8614046 missense probably benign 0.04
IGL01642:Abat APN 16 8600919 missense possibly damaging 0.81
IGL02024:Abat APN 16 8611136 missense probably damaging 1.00
IGL02071:Abat APN 16 8582812 missense probably damaging 1.00
R2853:Abat UTSW 16 8600968 missense probably damaging 1.00
R4839:Abat UTSW 16 8583648 intron probably benign
R4895:Abat UTSW 16 8615962 missense probably benign 0.00
R5378:Abat UTSW 16 8578277 missense probably benign 0.00
R5804:Abat UTSW 16 8578236 nonsense probably null
R6012:Abat UTSW 16 8582827 missense probably damaging 1.00
R6113:Abat UTSW 16 8572900 missense probably benign 0.01
R6122:Abat UTSW 16 8605550 missense probably benign 0.01
R6190:Abat UTSW 16 8605608 missense probably damaging 1.00
R6382:Abat UTSW 16 8600986 missense probably benign 0.11
R6426:Abat UTSW 16 8602436 intron probably benign
R6427:Abat UTSW 16 8602436 intron probably benign
R6428:Abat UTSW 16 8602436 intron probably benign
R6738:Abat UTSW 16 8602436 intron probably benign
R7009:Abat UTSW 16 8602367 missense probably benign 0.05
R7019:Abat UTSW 16 8618531 nonsense probably null
R7310:Abat UTSW 16 8605593 missense probably null 0.01
Predicted Primers PCR Primer
(F):5'- AAGTACTCATCCTGGACCCC -3'
(R):5'- GTTGAAATGGAACGATTTATGGCAG -3'

Sequencing Primer
(F):5'- ATCCTGGACCCCTCTGCAG -3'
(R):5'- CTGATCAGGACTGCCTAGGTATAC -3'
Posted On2018-04-02