Incidental Mutation 'R6328:Epg5'
ID510836
Institutional Source Beutler Lab
Gene Symbol Epg5
Ensembl Gene ENSMUSG00000039840
Gene Nameectopic P-granules autophagy protein 5 homolog (C. elegans)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R6328 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location77938467-78035027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78028964 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2397 (E2397G)
Ref Sequence ENSEMBL: ENSMUSP00000038681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044622]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044622
AA Change: E2397G

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: E2397G

DomainStartEndE-ValueType
low complexity region 299 309 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
low complexity region 1074 1085 N/A INTRINSIC
low complexity region 1499 1516 N/A INTRINSIC
coiled coil region 1600 1626 N/A INTRINSIC
low complexity region 2132 2145 N/A INTRINSIC
low complexity region 2416 2427 N/A INTRINSIC
low complexity region 2454 2469 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Abcb10 G A 8: 123,962,017 R507W probably damaging Het
Actg1 T C 11: 120,347,760 D80G possibly damaging Het
Actr5 A G 2: 158,635,344 D405G possibly damaging Het
Ahnak C T 19: 9,007,148 T1932I probably benign Het
Ankk1 T A 9: 49,416,071 T603S possibly damaging Het
Atp13a3 A T 16: 30,336,235 F964I probably damaging Het
Atp6v1g3 A G 1: 138,287,832 T77A probably benign Het
Bccip A G 7: 133,717,774 H198R probably damaging Het
Bsx A T 9: 40,874,223 R16W probably damaging Het
Ccdc88b C T 19: 6,849,038 R1103Q probably damaging Het
Cd59a A C 2: 104,110,758 Y27S probably damaging Het
Cdk20 A G 13: 64,436,599 H162R probably damaging Het
Col6a2 C T 10: 76,614,378 E240K possibly damaging Het
Ddr2 A G 1: 169,987,065 V603A possibly damaging Het
Dgkz A G 2: 91,942,635 V359A probably benign Het
Dis3l2 T A 1: 86,854,431 S223T probably benign Het
Dpysl4 A G 7: 139,099,818 S535G probably benign Het
Dsp A T 13: 38,197,006 K1977* probably null Het
Dync2h1 A T 9: 7,165,717 S515T probably benign Het
Fam83d G A 2: 158,785,176 G262S probably damaging Het
Frmd4a A T 2: 4,590,698 T477S probably damaging Het
Gbp3 A G 3: 142,569,058 E382G probably benign Het
Gltp A T 5: 114,670,511 C157S possibly damaging Het
Grb10 A G 11: 11,937,905 S378P probably damaging Het
Gulo G T 14: 66,002,631 T126K probably damaging Het
H2-M10.6 T A 17: 36,813,944 M251K probably damaging Het
Hecw1 T C 13: 14,247,620 D967G possibly damaging Het
Htr3b A T 9: 48,947,633 D68E probably damaging Het
Igkv5-39 G T 6: 69,900,505 S89* probably null Het
Kctd4 C A 14: 75,962,597 probably benign Het
Lmna T C 3: 88,486,506 Q255R probably damaging Het
Lsmem1 A G 12: 40,180,657 I82T possibly damaging Het
Lyg2 T A 1: 37,911,113 M45L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Nudt5 A T 2: 5,864,437 K158I possibly damaging Het
Nufip1 C T 14: 76,111,054 P41L possibly damaging Het
Olfr1307 A T 2: 111,945,394 W21R probably null Het
Olfr618 A T 7: 103,597,866 E183D probably damaging Het
Pcp2 T C 8: 3,624,887 D22G probably damaging Het
Pdk2 G C 11: 95,039,402 N69K possibly damaging Het
Pdlim7 G T 13: 55,508,092 probably benign Het
Ptprc C A 1: 138,113,678 E148* probably null Het
Rassf5 A T 1: 131,180,668 V225E probably damaging Het
Rbm6 A T 9: 107,787,259 M725K probably benign Het
Scn1a T A 2: 66,273,316 I1867F probably damaging Het
Sdk2 T A 11: 113,793,755 Q1960L probably damaging Het
Setx A G 2: 29,174,462 probably benign Het
Sgo2b T A 8: 63,928,311 R496* probably null Het
Slco1a1 C T 6: 141,932,450 V222I probably damaging Het
Sntg2 A C 12: 30,258,014 L224R probably damaging Het
Syt16 C A 12: 74,266,693 C464* probably null Het
Tapbpl T A 6: 125,224,918 S420C probably benign Het
Tax1bp1 A G 6: 52,746,709 E528G probably benign Het
Tmem168 T C 6: 13,602,711 T219A probably benign Het
Zfp180 T C 7: 24,105,556 F467L probably damaging Het
Other mutations in Epg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Epg5 APN 18 78012741 missense probably damaging 1.00
IGL01778:Epg5 APN 18 78019274 missense probably damaging 0.98
IGL01936:Epg5 APN 18 77985101 missense probably damaging 1.00
IGL02189:Epg5 APN 18 78012870 missense probably damaging 0.99
IGL02323:Epg5 APN 18 78012832 nonsense probably null
IGL02567:Epg5 APN 18 78033073 missense probably damaging 1.00
IGL02805:Epg5 APN 18 78030191 splice site probably benign
IGL03282:Epg5 APN 18 77986426 missense probably benign 0.25
stitch UTSW 18 77948299 nonsense probably null
R0011:Epg5 UTSW 18 77948483 missense probably benign
R0172:Epg5 UTSW 18 78027359 missense probably benign 0.00
R0335:Epg5 UTSW 18 77986472 missense probably benign 0.25
R0380:Epg5 UTSW 18 77960841 missense probably damaging 1.00
R0441:Epg5 UTSW 18 78023271 splice site probably benign
R0443:Epg5 UTSW 18 77955903 splice site probably benign
R0445:Epg5 UTSW 18 78014184 missense possibly damaging 0.87
R0448:Epg5 UTSW 18 78023365 missense probably damaging 1.00
R0892:Epg5 UTSW 18 77968628 missense possibly damaging 0.94
R1081:Epg5 UTSW 18 77959533 missense possibly damaging 0.92
R1183:Epg5 UTSW 18 77960711 missense probably damaging 1.00
R1374:Epg5 UTSW 18 77981326 missense probably benign
R1428:Epg5 UTSW 18 77962427 missense probably damaging 1.00
R1727:Epg5 UTSW 18 78015815 missense possibly damaging 0.94
R1780:Epg5 UTSW 18 78023990 missense probably damaging 0.99
R1801:Epg5 UTSW 18 77983490 missense possibly damaging 0.63
R1864:Epg5 UTSW 18 77975031 missense probably damaging 0.99
R1908:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1909:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1916:Epg5 UTSW 18 77965021 missense probably benign 0.00
R1986:Epg5 UTSW 18 77982306 critical splice acceptor site probably null
R2048:Epg5 UTSW 18 78023987 missense probably damaging 0.98
R2080:Epg5 UTSW 18 77948745 missense probably benign 0.01
R2106:Epg5 UTSW 18 77991363 nonsense probably null
R2144:Epg5 UTSW 18 77954197 missense possibly damaging 0.78
R2151:Epg5 UTSW 18 78027302 missense probably benign
R2217:Epg5 UTSW 18 77949072 missense probably benign
R2424:Epg5 UTSW 18 77968613 missense probably benign 0.05
R2909:Epg5 UTSW 18 77983476 missense probably damaging 1.00
R3725:Epg5 UTSW 18 78017679 missense probably benign 0.00
R3899:Epg5 UTSW 18 77957510 missense probably damaging 1.00
R4019:Epg5 UTSW 18 78030450 missense probably damaging 0.98
R4260:Epg5 UTSW 18 77959121 missense possibly damaging 0.50
R4260:Epg5 UTSW 18 78015699 missense probably damaging 1.00
R4448:Epg5 UTSW 18 77962461 missense probably damaging 1.00
R4475:Epg5 UTSW 18 77948508 missense probably benign
R4612:Epg5 UTSW 18 77982414 missense possibly damaging 0.77
R4666:Epg5 UTSW 18 78012864 missense probably benign 0.45
R4767:Epg5 UTSW 18 78023283 missense possibly damaging 0.67
R4779:Epg5 UTSW 18 77991365 missense probably benign 0.01
R4791:Epg5 UTSW 18 77948996 nonsense probably null
R4797:Epg5 UTSW 18 78030399 missense probably benign 0.00
R4812:Epg5 UTSW 18 77979184 missense probably benign 0.01
R4899:Epg5 UTSW 18 77985057 missense probably damaging 1.00
R5000:Epg5 UTSW 18 77954161 missense probably benign
R5031:Epg5 UTSW 18 78028948 missense probably benign 0.00
R5050:Epg5 UTSW 18 77975941 missense possibly damaging 0.55
R5114:Epg5 UTSW 18 77995613 missense probably benign
R5144:Epg5 UTSW 18 78015680 missense probably damaging 1.00
R5209:Epg5 UTSW 18 77951282 missense probably damaging 1.00
R5213:Epg5 UTSW 18 78014834 missense probably benign 0.01
R5270:Epg5 UTSW 18 77983563 missense possibly damaging 0.79
R5324:Epg5 UTSW 18 77962445 missense possibly damaging 0.94
R5443:Epg5 UTSW 18 78027497 missense possibly damaging 0.55
R5503:Epg5 UTSW 18 77951207 missense possibly damaging 0.81
R5593:Epg5 UTSW 18 77957474 missense probably damaging 1.00
R5718:Epg5 UTSW 18 77986403 missense probably damaging 1.00
R5773:Epg5 UTSW 18 77960825 missense probably damaging 1.00
R5828:Epg5 UTSW 18 78020851 missense probably damaging 0.99
R5847:Epg5 UTSW 18 78030055 missense probably benign 0.06
R5858:Epg5 UTSW 18 77948299 nonsense probably null
R5914:Epg5 UTSW 18 77959632 critical splice donor site probably null
R6124:Epg5 UTSW 18 78030045 missense probably benign
R6228:Epg5 UTSW 18 77948462 missense possibly damaging 0.90
R6252:Epg5 UTSW 18 77985167 missense probably damaging 1.00
R6269:Epg5 UTSW 18 77948370 missense probably benign
R6312:Epg5 UTSW 18 77979211 missense possibly damaging 0.72
R6320:Epg5 UTSW 18 77962398 missense probably damaging 1.00
R6430:Epg5 UTSW 18 77975885 missense probably damaging 1.00
R6458:Epg5 UTSW 18 77948254 missense probably benign 0.03
R6852:Epg5 UTSW 18 78012891 missense probably damaging 1.00
R6915:Epg5 UTSW 18 77979165 missense probably benign 0.00
R6930:Epg5 UTSW 18 78014163 missense probably damaging 0.99
R6932:Epg5 UTSW 18 77948609 missense probably benign 0.00
R7127:Epg5 UTSW 18 78028925 missense probably damaging 1.00
R7207:Epg5 UTSW 18 77948955 missense probably damaging 1.00
R7225:Epg5 UTSW 18 78012702 missense probably benign 0.45
R7358:Epg5 UTSW 18 77959037 missense possibly damaging 0.78
R7414:Epg5 UTSW 18 77983532 missense possibly damaging 0.65
R7437:Epg5 UTSW 18 78023278 missense probably benign 0.01
R7535:Epg5 UTSW 18 78032926 missense probably benign 0.18
X0023:Epg5 UTSW 18 77968657 missense probably damaging 0.99
X0060:Epg5 UTSW 18 77962485 missense possibly damaging 0.94
Z1088:Epg5 UTSW 18 77959139 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGTTCTGGTGTCCCTTCAAG -3'
(R):5'- TCTTCAAGATACTTGTGTGAGGAG -3'

Sequencing Primer
(F):5'- GGTGTCCCTTCAAGTTCCCCAG -3'
(R):5'- GAGGCCGTCTGACTTTTA -3'
Posted On2018-04-02