Incidental Mutation 'R6330:Gbp7'
ID510847
Institutional Source Beutler Lab
Gene Symbol Gbp7
Ensembl Gene ENSMUSG00000040253
Gene Nameguanylate binding protein 7
Synonyms9830147J24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6330 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location142530342-142550149 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 142546498 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 614 (Y614F)
Ref Sequence ENSEMBL: ENSMUSP00000132970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045097] [ENSMUST00000171263]
Predicted Effect probably benign
Transcript: ENSMUST00000045097
AA Change: Y614F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049104
Gene: ENSMUSG00000040253
AA Change: Y614F

DomainStartEndE-ValueType
Pfam:GBP 18 281 6.6e-128 PFAM
Pfam:GBP_C 283 579 2.8e-127 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171263
AA Change: Y614F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132970
Gene: ENSMUSG00000040253
AA Change: Y614F

DomainStartEndE-ValueType
Pfam:GBP 18 281 1e-126 PFAM
Pfam:GBP_C 283 579 2.8e-127 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197826
Meta Mutation Damage Score 0.0668 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanylate-binding proteins, such as GBP7, are induced by interferon and hydrolyze GTP to both GDP and GMP (Olszewski et al., 2006 [PubMed 16689661]).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T A 16: 88,627,051 H184L probably benign Het
9230104L09Rik G T 2: 148,850,825 A19D probably damaging Het
Ccar1 A G 10: 62,764,533 Y540H probably damaging Het
Celf2 A G 2: 6,884,955 F2L probably benign Het
Cfap57 T C 4: 118,569,396 I1119V probably benign Het
Clec4f T C 6: 83,652,868 Q236R probably damaging Het
Cyp4a31 C T 4: 115,563,877 P54L probably damaging Het
Dapk1 T C 13: 60,761,326 V1251A probably benign Het
Dnah7b G A 1: 46,340,175 V3690M probably damaging Het
Dock9 A T 14: 121,605,243 M1K probably null Het
Emb T G 13: 117,249,130 probably null Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
F7 C T 8: 13,035,140 H389Y probably damaging Het
Fam111a T A 19: 12,586,902 I49K probably damaging Het
Fam50b T G 13: 34,746,669 S43A probably benign Het
Gli3 T A 13: 15,724,732 D901E probably damaging Het
Hhatl C T 9: 121,788,225 probably null Het
Idua T A 5: 108,681,708 L432H probably benign Het
Ighv10-3 T A 12: 114,523,466 T112S possibly damaging Het
Kcnj6 T A 16: 94,762,601 D346V possibly damaging Het
Lrba A G 3: 86,348,357 D1002G probably benign Het
Lrrd1 T A 5: 3,850,629 S311R probably damaging Het
Mafk A G 5: 139,799,193 N4S probably benign Het
Mfsd14b T C 13: 65,095,686 Y48C probably damaging Het
Mindy3 C T 2: 12,356,933 A333T probably damaging Het
Mlxip G A 5: 123,394,952 C8Y probably benign Het
Mthfd1l A T 10: 3,980,234 M110L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Olfr128 T C 17: 37,923,794 V76A possibly damaging Het
Olfr366 A T 2: 37,220,124 I212F probably benign Het
Orc2 C A 1: 58,500,334 V49L probably benign Het
Pfkp C T 13: 6,585,250 probably benign Het
Pkd1l3 T C 8: 109,646,909 F1359S probably benign Het
Ralgps1 A T 2: 33,174,443 I222N probably damaging Het
Rrad T G 8: 104,629,860 E136A probably benign Het
Serpine3 T C 14: 62,664,981 S14P probably benign Het
Slc2a12 A G 10: 22,664,995 T250A probably benign Het
Slc4a5 T G 6: 83,226,374 F85L probably benign Het
Stx18 T A 5: 38,126,917 probably null Het
Tbcd T C 11: 121,497,086 S348P probably benign Het
Usp9y T C Y: 1,340,123 T1419A probably benign Homo
Vmn2r69 T C 7: 85,411,627 S250G probably benign Het
Vmn2r86 A G 10: 130,446,527 V740A probably benign Het
Vwa5b2 T A 16: 20,601,977 I846N probably damaging Het
Zfp74 A T 7: 29,937,987 Y33N probably damaging Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Other mutations in Gbp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Gbp7 APN 3 142546428 missense probably benign 0.01
IGL01020:Gbp7 APN 3 142542857 missense probably benign 0.03
IGL01959:Gbp7 APN 3 142541347 splice site probably benign
IGL02002:Gbp7 APN 3 142538900 missense probably damaging 1.00
IGL02008:Gbp7 APN 3 142546450 missense probably benign 0.11
PIT4366001:Gbp7 UTSW 3 142542951 missense probably benign
R0103:Gbp7 UTSW 3 142546538 missense probably benign
R0103:Gbp7 UTSW 3 142546538 missense probably benign
R0398:Gbp7 UTSW 3 142545513 missense possibly damaging 0.93
R0486:Gbp7 UTSW 3 142546317 splice site probably benign
R0645:Gbp7 UTSW 3 142538165 intron probably null
R0961:Gbp7 UTSW 3 142541557 nonsense probably null
R1834:Gbp7 UTSW 3 142534680 missense probably damaging 1.00
R2089:Gbp7 UTSW 3 142534622 missense probably damaging 0.97
R2089:Gbp7 UTSW 3 142545555 splice site probably benign
R2091:Gbp7 UTSW 3 142534622 missense probably damaging 0.97
R2091:Gbp7 UTSW 3 142545555 splice site probably benign
R2091:Gbp7 UTSW 3 142534622 missense probably damaging 0.97
R2181:Gbp7 UTSW 3 142544030 missense possibly damaging 0.87
R2921:Gbp7 UTSW 3 142534572 missense probably benign 0.00
R2922:Gbp7 UTSW 3 142534572 missense probably benign 0.00
R3819:Gbp7 UTSW 3 142544065 missense possibly damaging 0.81
R4747:Gbp7 UTSW 3 142543017 missense probably damaging 1.00
R4748:Gbp7 UTSW 3 142538087 missense probably benign 0.00
R5899:Gbp7 UTSW 3 142546542 missense probably benign
R6082:Gbp7 UTSW 3 142545936 missense probably benign 0.01
R6211:Gbp7 UTSW 3 142545993 missense probably benign 0.12
R6419:Gbp7 UTSW 3 142546453 missense probably benign 0.00
R7120:Gbp7 UTSW 3 142543973 missense probably damaging 1.00
R7338:Gbp7 UTSW 3 142538025 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGTCAATAGGCATGGTTTTC -3'
(R):5'- GGGGTCTTGCCATTAATTTATAGAG -3'

Sequencing Primer
(F):5'- ACAGATTCAAAAAGACATGCTTAATG -3'
(R):5'- TTGCCATTAATTTATAGAGAGTGACC -3'
Posted On2018-04-02