Incidental Mutation 'R6330:Slc2a12'
ID510863
Institutional Source Beutler Lab
Gene Symbol Slc2a12
Ensembl Gene ENSMUSG00000037490
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 12
SynonymsGlut12, GLUT-12
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6330 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location22645011-22704285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22664995 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 250 (T250A)
Ref Sequence ENSEMBL: ENSMUSP00000043962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042261]
Predicted Effect probably benign
Transcript: ENSMUST00000042261
AA Change: T250A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000043962
Gene: ENSMUSG00000037490
AA Change: T250A

DomainStartEndE-ValueType
Pfam:MFS_1 42 390 5.3e-27 PFAM
Pfam:Sugar_tr 47 381 9.1e-76 PFAM
Pfam:Sugar_tr 451 569 4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159174
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC2A12 belongs to a family of transporters that catalyze the uptake of sugars through facilitated diffusion (Rogers et al., 2002). This family of transporters show conservation of 12 transmembrane helices as well as functionally significant amino acid residues (Joost and Thorens, 2001 [PubMed 11780753]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T A 16: 88,627,051 H184L probably benign Het
9230104L09Rik G T 2: 148,850,825 A19D probably damaging Het
Ccar1 A G 10: 62,764,533 Y540H probably damaging Het
Celf2 A G 2: 6,884,955 F2L probably benign Het
Cfap57 T C 4: 118,569,396 I1119V probably benign Het
Clec4f T C 6: 83,652,868 Q236R probably damaging Het
Cyp4a31 C T 4: 115,563,877 P54L probably damaging Het
Dapk1 T C 13: 60,761,326 V1251A probably benign Het
Dnah7b G A 1: 46,340,175 V3690M probably damaging Het
Dock9 A T 14: 121,605,243 M1K probably null Het
Emb T G 13: 117,249,130 probably null Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
F7 C T 8: 13,035,140 H389Y probably damaging Het
Fam111a T A 19: 12,586,902 I49K probably damaging Het
Fam50b T G 13: 34,746,669 S43A probably benign Het
Gbp7 A T 3: 142,546,498 Y614F probably benign Het
Gli3 T A 13: 15,724,732 D901E probably damaging Het
Hhatl C T 9: 121,788,225 probably null Het
Idua T A 5: 108,681,708 L432H probably benign Het
Ighv10-3 T A 12: 114,523,466 T112S possibly damaging Het
Kcnj6 T A 16: 94,762,601 D346V possibly damaging Het
Lrba A G 3: 86,348,357 D1002G probably benign Het
Lrrd1 T A 5: 3,850,629 S311R probably damaging Het
Mafk A G 5: 139,799,193 N4S probably benign Het
Mfsd14b T C 13: 65,095,686 Y48C probably damaging Het
Mindy3 C T 2: 12,356,933 A333T probably damaging Het
Mlxip G A 5: 123,394,952 C8Y probably benign Het
Mthfd1l A T 10: 3,980,234 M110L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Olfr128 T C 17: 37,923,794 V76A possibly damaging Het
Olfr366 A T 2: 37,220,124 I212F probably benign Het
Orc2 C A 1: 58,500,334 V49L probably benign Het
Pfkp C T 13: 6,585,250 probably benign Het
Pkd1l3 T C 8: 109,646,909 F1359S probably benign Het
Ralgps1 A T 2: 33,174,443 I222N probably damaging Het
Rrad T G 8: 104,629,860 E136A probably benign Het
Serpine3 T C 14: 62,664,981 S14P probably benign Het
Slc4a5 T G 6: 83,226,374 F85L probably benign Het
Stx18 T A 5: 38,126,917 probably null Het
Tbcd T C 11: 121,497,086 S348P probably benign Het
Usp9y T C Y: 1,340,123 T1419A probably benign Homo
Vmn2r69 T C 7: 85,411,627 S250G probably benign Het
Vmn2r86 A G 10: 130,446,527 V740A probably benign Het
Vwa5b2 T A 16: 20,601,977 I846N probably damaging Het
Zfp74 A T 7: 29,937,987 Y33N probably damaging Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Other mutations in Slc2a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Slc2a12 APN 10 22664684 missense probably damaging 0.97
IGL02472:Slc2a12 APN 10 22665155 missense probably damaging 1.00
IGL03387:Slc2a12 APN 10 22665235 missense probably damaging 1.00
IGL03412:Slc2a12 APN 10 22664969 missense probably damaging 1.00
R0537:Slc2a12 UTSW 10 22665068 missense probably damaging 1.00
R0539:Slc2a12 UTSW 10 22692230 missense probably benign 0.04
R0744:Slc2a12 UTSW 10 22702016 unclassified probably benign
R0833:Slc2a12 UTSW 10 22702016 unclassified probably benign
R1056:Slc2a12 UTSW 10 22665451 missense probably benign 0.05
R1926:Slc2a12 UTSW 10 22665242 missense probably damaging 1.00
R2188:Slc2a12 UTSW 10 22664837 missense probably benign 0.01
R2471:Slc2a12 UTSW 10 22664807 missense probably damaging 1.00
R4212:Slc2a12 UTSW 10 22702094 missense probably benign 0.02
R4213:Slc2a12 UTSW 10 22702094 missense probably benign 0.02
R4543:Slc2a12 UTSW 10 22664786 missense probably damaging 1.00
R5203:Slc2a12 UTSW 10 22645314 critical splice donor site probably null
R5203:Slc2a12 UTSW 10 22692218 missense probably benign
R5223:Slc2a12 UTSW 10 22702032 missense probably damaging 0.99
R5500:Slc2a12 UTSW 10 22665137 missense probably damaging 1.00
R6119:Slc2a12 UTSW 10 22665347 missense probably damaging 1.00
R6149:Slc2a12 UTSW 10 22664502 missense probably benign 0.05
R6281:Slc2a12 UTSW 10 22665320 missense probably damaging 1.00
R6385:Slc2a12 UTSW 10 22694030 missense possibly damaging 0.69
R6623:Slc2a12 UTSW 10 22664900 missense probably damaging 1.00
R6895:Slc2a12 UTSW 10 22692185 missense probably damaging 1.00
R7080:Slc2a12 UTSW 10 22665317 missense probably benign 0.34
R7152:Slc2a12 UTSW 10 22665554 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGAGCTGATGATTGTCACTGG -3'
(R):5'- CTCTGGAAGCCAACAGACTTC -3'

Sequencing Primer
(F):5'- CAAATTATGCATTTGCCAACATCTCC -3'
(R):5'- CAGACTTCAAGACAGTTGATGC -3'
Posted On2018-04-02