Incidental Mutation 'R6330:Gli3'
ID510869
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene NameGLI-Kruppel family member GLI3
Synonymsbrachyphalangy, Bph
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6330 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location15463235-15730026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15724732 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 901 (D901E)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510]
Predicted Effect probably damaging
Transcript: ENSMUST00000110510
AA Change: D901E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: D901E

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T A 16: 88,627,051 H184L probably benign Het
9230104L09Rik G T 2: 148,850,825 A19D probably damaging Het
Ccar1 A G 10: 62,764,533 Y540H probably damaging Het
Celf2 A G 2: 6,884,955 F2L probably benign Het
Cfap57 T C 4: 118,569,396 I1119V probably benign Het
Clec4f T C 6: 83,652,868 Q236R probably damaging Het
Cyp4a31 C T 4: 115,563,877 P54L probably damaging Het
Dapk1 T C 13: 60,761,326 V1251A probably benign Het
Dnah7b G A 1: 46,340,175 V3690M probably damaging Het
Dock9 A T 14: 121,605,243 M1K probably null Het
Emb T G 13: 117,249,130 probably null Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
F7 C T 8: 13,035,140 H389Y probably damaging Het
Fam111a T A 19: 12,586,902 I49K probably damaging Het
Fam50b T G 13: 34,746,669 S43A probably benign Het
Gbp7 A T 3: 142,546,498 Y614F probably benign Het
Hhatl C T 9: 121,788,225 probably null Het
Idua T A 5: 108,681,708 L432H probably benign Het
Ighv10-3 T A 12: 114,523,466 T112S possibly damaging Het
Kcnj6 T A 16: 94,762,601 D346V possibly damaging Het
Lrba A G 3: 86,348,357 D1002G probably benign Het
Lrrd1 T A 5: 3,850,629 S311R probably damaging Het
Mafk A G 5: 139,799,193 N4S probably benign Het
Mfsd14b T C 13: 65,095,686 Y48C probably damaging Het
Mindy3 C T 2: 12,356,933 A333T probably damaging Het
Mlxip G A 5: 123,394,952 C8Y probably benign Het
Mthfd1l A T 10: 3,980,234 M110L probably benign Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Olfr128 T C 17: 37,923,794 V76A possibly damaging Het
Olfr366 A T 2: 37,220,124 I212F probably benign Het
Orc2 C A 1: 58,500,334 V49L probably benign Het
Pfkp C T 13: 6,585,250 probably benign Het
Pkd1l3 T C 8: 109,646,909 F1359S probably benign Het
Ralgps1 A T 2: 33,174,443 I222N probably damaging Het
Rrad T G 8: 104,629,860 E136A probably benign Het
Serpine3 T C 14: 62,664,981 S14P probably benign Het
Slc2a12 A G 10: 22,664,995 T250A probably benign Het
Slc4a5 T G 6: 83,226,374 F85L probably benign Het
Stx18 T A 5: 38,126,917 probably null Het
Tbcd T C 11: 121,497,086 S348P probably benign Het
Usp9y T C Y: 1,340,123 T1419A probably benign Homo
Vmn2r69 T C 7: 85,411,627 S250G probably benign Het
Vmn2r86 A G 10: 130,446,527 V740A probably benign Het
Vwa5b2 T A 16: 20,601,977 I846N probably damaging Het
Zfp74 A T 7: 29,937,987 Y33N probably damaging Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15644299 missense probably damaging 1.00
IGL00471:Gli3 APN 13 15723769 critical splice donor site probably null
IGL00484:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15548398 critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15648634 missense probably damaging 1.00
IGL01799:Gli3 APN 13 15726161 missense probably benign 0.00
IGL01861:Gli3 APN 13 15725325 missense probably damaging 1.00
IGL02063:Gli3 APN 13 15726372 missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15662514 missense probably damaging 1.00
IGL02255:Gli3 APN 13 15648719 missense probably damaging 1.00
IGL02270:Gli3 APN 13 15726786 utr 3 prime probably benign
IGL02336:Gli3 APN 13 15720289 missense probably damaging 1.00
IGL02346:Gli3 APN 13 15723693 missense probably damaging 1.00
IGL02744:Gli3 APN 13 15613886 critical splice donor site probably null
IGL02877:Gli3 APN 13 15724742 missense probably damaging 1.00
IGL02975:Gli3 APN 13 15724568 missense probably damaging 1.00
IGL03018:Gli3 APN 13 15660132 missense probably damaging 1.00
IGL03378:Gli3 APN 13 15644420 missense probably damaging 1.00
IGL03406:Gli3 APN 13 15648581 missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15644357 missense probably damaging 1.00
R0110:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0329:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0330:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0360:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0364:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0469:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0616:Gli3 UTSW 13 15662406 missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15724715 missense probably damaging 1.00
R1072:Gli3 UTSW 13 15713605 missense probably damaging 1.00
R1257:Gli3 UTSW 13 15725996 nonsense probably null
R1270:Gli3 UTSW 13 15723744 missense probably benign 0.02
R1424:Gli3 UTSW 13 15726314 missense probably benign 0.00
R1481:Gli3 UTSW 13 15613850 missense probably damaging 0.99
R1596:Gli3 UTSW 13 15725471 missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15726312 missense probably benign 0.00
R1721:Gli3 UTSW 13 15726297 missense probably benign 0.27
R1797:Gli3 UTSW 13 15713512 missense probably damaging 0.99
R1813:Gli3 UTSW 13 15648691 missense probably damaging 1.00
R1819:Gli3 UTSW 13 15725792 nonsense probably null
R1988:Gli3 UTSW 13 15726380 missense probably benign
R2132:Gli3 UTSW 13 15725549 missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15662392 missense probably benign 0.02
R3085:Gli3 UTSW 13 15660941 missense probably damaging 1.00
R3177:Gli3 UTSW 13 15725982 missense probably benign 0.28
R3277:Gli3 UTSW 13 15725982 missense probably benign 0.28
R4162:Gli3 UTSW 13 15725115 missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15723571 missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15713631 missense probably damaging 1.00
R4979:Gli3 UTSW 13 15724464 missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15548507 missense probably damaging 0.99
R5395:Gli3 UTSW 13 15714950 missense probably damaging 1.00
R5494:Gli3 UTSW 13 15725982 missense probably benign 0.28
R5609:Gli3 UTSW 13 15548453 missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15478165 critical splice donor site probably null
R5810:Gli3 UTSW 13 15644309 missense probably damaging 0.99
R5896:Gli3 UTSW 13 15726180 missense probably benign 0.00
R5930:Gli3 UTSW 13 15548625 missense probably damaging 1.00
R5964:Gli3 UTSW 13 15726162 nonsense probably null
R5985:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6224:Gli3 UTSW 13 15725145 missense probably benign
R6278:Gli3 UTSW 13 15725113 missense possibly damaging 0.69
R6383:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6523:Gli3 UTSW 13 15713650 critical splice donor site probably null
R7072:Gli3 UTSW 13 15725695 missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15715062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGAACACACTCAACAGG -3'
(R):5'- ATCTTCGAGGAGGATGGACTGG -3'

Sequencing Primer
(F):5'- TCAACAGGAGAGACAGCAATACCAG -3'
(R):5'- TTCCCCTAGCAAGGCCATC -3'
Posted On2018-04-02