Incidental Mutation 'R6331:Gcc2'
ID510927
Institutional Source Beutler Lab
Gene Symbol Gcc2
Ensembl Gene ENSMUSG00000038039
Gene NameGRIP and coiled-coil domain containing 2
Synonyms2600014C01Rik, 0610043A03Rik, 2210420P05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R6331 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location58255497-58305599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58271465 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 741 (V741A)
Ref Sequence ENSEMBL: ENSMUSP00000124152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057659] [ENSMUST00000160416] [ENSMUST00000160427] [ENSMUST00000162041] [ENSMUST00000162860] [ENSMUST00000162984]
Predicted Effect probably benign
Transcript: ENSMUST00000057659
AA Change: V841A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054033
Gene: ENSMUSG00000038039
AA Change: V841A

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
coiled coil region 33 282 N/A INTRINSIC
internal_repeat_2 353 378 3.94e-5 PROSPERO
internal_repeat_2 382 406 3.94e-5 PROSPERO
coiled coil region 790 882 N/A INTRINSIC
low complexity region 939 964 N/A INTRINSIC
internal_repeat_1 1093 1111 1.93e-5 PROSPERO
low complexity region 1115 1132 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
coiled coil region 1441 1470 N/A INTRINSIC
internal_repeat_1 1554 1572 1.93e-5 PROSPERO
Grip 1608 1655 4.37e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160416
SMART Domains Protein: ENSMUSP00000123873
Gene: ENSMUSG00000038039

DomainStartEndE-ValueType
coiled coil region 37 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160427
SMART Domains Protein: ENSMUSP00000124411
Gene: ENSMUSG00000038039

DomainStartEndE-ValueType
coiled coil region 32 94 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161570
Predicted Effect probably benign
Transcript: ENSMUST00000162041
AA Change: V805A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124787
Gene: ENSMUSG00000038039
AA Change: V805A

DomainStartEndE-ValueType
coiled coil region 32 246 N/A INTRINSIC
internal_repeat_2 317 342 3.28e-5 PROSPERO
internal_repeat_2 346 370 3.28e-5 PROSPERO
coiled coil region 754 846 N/A INTRINSIC
low complexity region 903 928 N/A INTRINSIC
internal_repeat_1 1057 1075 1.6e-5 PROSPERO
low complexity region 1079 1096 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
coiled coil region 1405 1434 N/A INTRINSIC
internal_repeat_1 1518 1536 1.6e-5 PROSPERO
Grip 1572 1619 4.37e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162860
AA Change: V741A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124152
Gene: ENSMUSG00000038039
AA Change: V741A

DomainStartEndE-ValueType
coiled coil region 46 182 N/A INTRINSIC
internal_repeat_2 253 278 4.17e-5 PROSPERO
internal_repeat_2 282 306 4.17e-5 PROSPERO
coiled coil region 690 782 N/A INTRINSIC
low complexity region 839 864 N/A INTRINSIC
internal_repeat_1 993 1011 2.06e-5 PROSPERO
low complexity region 1015 1032 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
coiled coil region 1341 1370 N/A INTRINSIC
internal_repeat_1 1450 1468 2.06e-5 PROSPERO
Grip 1504 1551 4.37e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162984
SMART Domains Protein: ENSMUSP00000124988
Gene: ENSMUSG00000038039

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Meta Mutation Damage Score 0.0664 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein localized to the trans-Golgi network. It is sensitive to brefeldin A. This encoded protein contains a GRIP domain which is thought to be used in targeting. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G A 18: 12,180,514 R228H probably damaging Het
9930021J03Rik C T 19: 29,717,747 V1449I probably benign Het
A2ml1 T C 6: 128,552,236 D981G probably damaging Het
Abcc1 C A 16: 14,465,056 A1132D probably damaging Het
Adamts12 A G 15: 11,241,433 T364A probably damaging Het
Ahnak A T 19: 9,006,625 M1758L probably benign Het
Ak9 T C 10: 41,382,829 V774A probably damaging Het
Ash1l A G 3: 89,007,865 E1934G probably benign Het
Atp2b2 C T 6: 113,797,131 A341T probably benign Het
Bach2 G T 4: 32,238,816 probably benign Het
Ccdc102a T C 8: 94,911,516 T241A probably benign Het
Chd5 G T 4: 152,382,408 R1627S probably benign Het
Clint1 T C 11: 45,895,081 S322P probably benign Het
Dapk1 T A 13: 60,729,442 C498* probably null Het
Diaph3 T G 14: 86,866,540 S803R probably damaging Het
Dmp1 T C 5: 104,207,125 L10P probably damaging Het
Gldn A G 9: 54,286,878 M119V probably benign Het
Gucy1b1 A G 3: 82,034,411 S574P possibly damaging Het
Hapln4 T A 8: 70,084,423 probably benign Het
Hars A G 18: 36,771,332 V209A probably benign Het
Htt T A 5: 34,895,887 F2521L possibly damaging Het
Kif14 A G 1: 136,515,986 D1299G probably null Het
Krt25 T A 11: 99,317,427 E325V probably damaging Het
Lcmt1 T C 7: 123,378,182 probably benign Het
Lrp1b A T 2: 40,803,209 N3266K probably damaging Het
Marc2 A G 1: 184,819,328 S304P probably damaging Het
Mctp1 T A 13: 77,020,863 probably null Het
Myo5b G A 18: 74,616,993 A176T probably damaging Het
Myom3 A G 4: 135,776,377 N379S possibly damaging Het
Nbea A T 3: 56,000,616 D1358E possibly damaging Het
Nod1 T C 6: 54,924,983 E939G probably damaging Het
Obox1 A G 7: 15,555,369 R70G probably benign Het
Olfr1024 T C 2: 85,904,216 I279M probably benign Het
Olfr1239 C T 2: 89,418,351 G21S probably benign Het
Olfr1341 A G 4: 118,709,947 E180G probably benign Het
Olfr272 A G 4: 52,911,399 Y132H probably damaging Het
Otof T C 5: 30,371,935 D1745G possibly damaging Het
Pklr A G 3: 89,137,355 I47V probably damaging Het
Pms2 T A 5: 143,914,633 S123T possibly damaging Het
Pnpla2 T C 7: 141,459,285 S337P probably damaging Het
Ptgfrn A C 3: 101,045,620 V766G possibly damaging Het
Ptpn11 T A 5: 121,144,653 H419L probably damaging Het
Rims3 T A 4: 120,883,153 V99E probably damaging Het
Samd9l A G 6: 3,376,361 V300A probably damaging Het
Sdad1 T C 5: 92,303,930 D144G probably damaging Het
Siglecg T C 7: 43,408,754 Y22H possibly damaging Het
Slc39a1 A G 3: 90,252,281 K305R possibly damaging Het
Slc5a4a A G 10: 76,178,200 R414G probably damaging Het
Smg1 T C 7: 118,154,277 probably benign Het
Tbc1d9b C T 11: 50,131,497 A20V possibly damaging Het
Tgfb3 G T 12: 86,063,864 D237E probably benign Het
Tle6 A G 10: 81,595,239 S234P probably benign Het
Tnrc6b A G 15: 80,879,614 N439S probably benign Het
Trim33 T C 3: 103,341,609 S783P probably benign Het
Ttn A T 2: 76,802,354 Y12373N probably damaging Het
Tube1 G A 10: 39,134,101 V7I probably benign Het
Tufm T C 7: 126,489,238 V265A probably benign Het
Uhrf1bp1 T C 17: 27,893,201 I1150T probably benign Het
Usp32 T C 11: 84,986,576 H1550R possibly damaging Het
Usp33 A T 3: 152,376,250 M546L probably damaging Het
Uspl1 C A 5: 149,214,287 Q752K probably benign Het
Vmn1r20 A G 6: 57,431,670 probably null Het
Vmn1r201 T C 13: 22,475,351 F245S probably damaging Het
Vmn2r3 A G 3: 64,278,761 S168P probably damaging Het
Wdr24 T G 17: 25,825,676 D168E possibly damaging Het
Zfp646 C T 7: 127,883,681 P1677S probably damaging Het
Other mutations in Gcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Gcc2 APN 10 58292680 missense probably damaging 1.00
IGL00850:Gcc2 APN 10 58258248 missense probably benign 0.00
IGL00935:Gcc2 APN 10 58278779 splice site probably benign
IGL01551:Gcc2 APN 10 58298869 splice site probably benign
IGL01642:Gcc2 APN 10 58280612 missense probably benign 0.00
IGL02041:Gcc2 APN 10 58269281 missense probably damaging 1.00
IGL02215:Gcc2 APN 10 58271636 missense probably benign 0.36
IGL02448:Gcc2 APN 10 58292571 nonsense probably null
IGL02698:Gcc2 APN 10 58271290 missense possibly damaging 0.76
IGL02888:Gcc2 APN 10 58294828 missense probably damaging 1.00
IGL02936:Gcc2 APN 10 58296140 missense probably damaging 1.00
IGL03223:Gcc2 APN 10 58298734 missense probably damaging 1.00
IGL03249:Gcc2 APN 10 58270992 nonsense probably null
R0179:Gcc2 UTSW 10 58276650 missense probably benign 0.39
R0528:Gcc2 UTSW 10 58298689 missense probably damaging 1.00
R1569:Gcc2 UTSW 10 58270171 missense probably benign 0.00
R1606:Gcc2 UTSW 10 58269448 missense probably damaging 1.00
R1725:Gcc2 UTSW 10 58304115 missense possibly damaging 0.95
R1916:Gcc2 UTSW 10 58276663 missense probably damaging 1.00
R1956:Gcc2 UTSW 10 58286143 missense possibly damaging 0.66
R2058:Gcc2 UTSW 10 58285957 missense probably benign 0.10
R2114:Gcc2 UTSW 10 58269540 nonsense probably null
R2280:Gcc2 UTSW 10 58269680 missense probably benign 0.38
R2435:Gcc2 UTSW 10 58294780 missense probably damaging 1.00
R2876:Gcc2 UTSW 10 58290302 missense probably damaging 0.99
R4753:Gcc2 UTSW 10 58290382 missense probably benign 0.20
R4827:Gcc2 UTSW 10 58286131 critical splice acceptor site probably null
R4911:Gcc2 UTSW 10 58270439 missense probably damaging 1.00
R5033:Gcc2 UTSW 10 58278806 missense probably damaging 0.98
R5224:Gcc2 UTSW 10 58286160 missense probably damaging 1.00
R5271:Gcc2 UTSW 10 58269695 missense possibly damaging 0.46
R5398:Gcc2 UTSW 10 58269507 missense probably benign 0.00
R5411:Gcc2 UTSW 10 58270969 missense probably damaging 0.99
R5594:Gcc2 UTSW 10 58287242 missense probably damaging 0.99
R5825:Gcc2 UTSW 10 58294821 missense probably damaging 1.00
R5974:Gcc2 UTSW 10 58258243 missense probably damaging 0.99
R5987:Gcc2 UTSW 10 58255847 utr 5 prime probably benign
R6195:Gcc2 UTSW 10 58270984 missense probably damaging 0.96
R6198:Gcc2 UTSW 10 58292590 missense probably benign 0.26
R6233:Gcc2 UTSW 10 58270984 missense probably damaging 0.96
R6349:Gcc2 UTSW 10 58269474 missense probably benign 0.01
R6593:Gcc2 UTSW 10 58271507 missense probably damaging 1.00
R6632:Gcc2 UTSW 10 58270049 unclassified probably null
R6647:Gcc2 UTSW 10 58287281 critical splice donor site probably null
R6774:Gcc2 UTSW 10 58281439 missense possibly damaging 0.94
R6808:Gcc2 UTSW 10 58258242 missense probably damaging 0.99
R7072:Gcc2 UTSW 10 58270927 missense probably benign 0.02
R7220:Gcc2 UTSW 10 58280594 missense probably benign 0.00
R7352:Gcc2 UTSW 10 58280698 critical splice donor site probably null
R7384:Gcc2 UTSW 10 58269964 missense probably damaging 1.00
R7439:Gcc2 UTSW 10 58256901 missense probably benign 0.08
R7441:Gcc2 UTSW 10 58256901 missense probably benign 0.08
X0018:Gcc2 UTSW 10 58278814 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAAGCTGTAGGTGAATCTTTAGTG -3'
(R):5'- TTCCCTCTGTTTAAGCAGTAGC -3'

Sequencing Primer
(F):5'- AGGTGAATCTTTAGTGAAAGTAAAGG -3'
(R):5'- CCTCTGTTTAAGCAGTAGCCTTAGG -3'
Posted On2018-04-02