Incidental Mutation 'FR4304:Dnah12'
ID511042
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Namedynein, axonemal, heavy chain 12
SynonymsDHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.587) question?
Stock #FR4304 ()
Quality Score221.999
Status Not validated
Chromosome14
Chromosomal Location26693274-26891703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 26849385 bp
ZygosityHomozygous
Amino Acid Change Glycine to Valine at position 2817 (G2817V)
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433]
Predicted Effect probably damaging
Transcript: ENSMUST00000022433
AA Change: G2817V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: G2817V

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165269
AA Change: G197V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130609
Gene: ENSMUSG00000021879
AA Change: G197V

DomainStartEndE-ValueType
Pfam:MT 1 248 5.7e-40 PFAM
Pfam:AAA_9 270 495 3.8e-96 PFAM
low complexity region 593 606 N/A INTRINSIC
Pfam:Dynein_heavy 631 1336 2e-287 PFAM
Meta Mutation Damage Score 0.0388 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 137 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik CTT CTTTTT 12: 110,668,449 probably benign Homo
1700001K19Rik TTC TTCGTC 12: 110,668,450 probably benign Homo
4930402H24Rik TCC TCCCCC 2: 130,770,748 probably benign Het
4930433I11Rik ACCTC AC 7: 40,993,056 probably benign Het
4930447C04Rik AAGT A 12: 72,881,287 probably benign Homo
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Homo
Acbd4 CAG CAGACTAG 11: 103,104,105 probably null Homo
Ahdc1 CT CTCTT 4: 133,062,759 probably benign Homo
Alpk3 TCT TCTGCT 7: 81,077,762 probably benign Het
Anapc4 C T 5: 52,864,526 T650M probably damaging Homo
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,560,924 probably benign Het
Ankrd35 TAGC TAGCAGC 3: 96,683,847 probably benign Homo
Apc GCCAATAAA GCCAATAAAACCAATAAA 18: 34,281,997 probably benign Het
Apol6 TTGT TTGTCTGT 15: 77,051,436 probably null Het
Arhgap30 TGGCCC TGGCCCTGGCCCAGGCCTTGGCCCCGGCCC 1: 171,405,168 probably benign Het
Arpc1b GCC GCCTGTCC 5: 145,126,791 probably null Het
BC051142 A AGCC 17: 34,460,055 probably benign Het
BC051142 GC GCATC 17: 34,460,077 probably benign Het
Blm CT CTACGT 7: 80,463,773 probably null Homo
Blm TCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCC 7: 80,512,919 probably benign Het
Btnl10 GA GAATA 11: 58,923,930 probably benign Homo
Cacna1f AGG AGGCGG X: 7,620,061 probably benign Het
Calhm3 CG CGG 19: 47,151,896 probably null Homo
Catsper2 C CTTTTACTTTTTA 2: 121,397,542 probably null Homo
Catsper2 CAT CATTAT 2: 121,397,782 probably benign Het
Ccdc15 AC ACTTTCC 9: 37,315,157 probably null Het
Ccdc162 T C 10: 41,556,121 D1792G possibly damaging Het
Ccdc170 CCA CCATCA 10: 4,561,021 probably benign Het
Ccdc73 TAAG T 2: 104,991,840 probably benign Homo
Ccdc85c GCC GCCCCC 12: 108,274,612 probably benign Het
Cd22 C T 7: 30,878,082 R2H possibly damaging Het
Cd80 AGA AGAGGA 16: 38,486,315 probably benign Homo
Cep89 GACT G 7: 35,409,641 probably benign Het
Cfap74 A G 4: 155,415,760 D21G possibly damaging Homo
Cgref1 T TCTA 5: 30,933,780 probably benign Homo
Chd4 GCC GCCACTCCC 6: 125,122,144 probably benign Het
Cnpy3 TCC TCCCCC 17: 46,736,743 probably benign Het
Cnpy3 TCC TCCACC 17: 46,736,746 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,581 probably benign Het
Cntnap1 CCCCAG CCCCAGACCCAG 11: 101,189,589 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Homo
Cpeb4 T TGA 11: 31,927,638 probably benign Homo
Cpne1 AGA AGAGAGA 2: 156,072,025 probably null Homo
Cttnbp2 ATTGCTG ATTGCTGTTGCTG 6: 18,367,458 probably benign Het
Dhx37 CTGG C 5: 125,427,530 probably benign Het
Dhx8 CGAGAC CGAGACGGAGAC 11: 101,738,188 probably benign Homo
Dst C A 1: 34,200,964 S1798Y probably damaging Het
Eif3a TA TATTTCA 19: 60,775,290 probably benign Homo
Ermn TTC TTCCTC 2: 58,048,078 probably benign Het
Ermn CTT CTTGTT 2: 58,048,086 probably benign Het
Fbxo43 GCCTGT GCCTGTTCCTGT 15: 36,152,094 probably benign Het
Fbxo43 TGTGCC TGTGCCAGTGCC 15: 36,152,097 probably benign Het
Fbxo43 GCCTGT GCCTGTCCCTGT 15: 36,152,100 probably benign Het
Fmn1 TCCTCC TCCTCCCCCTCC 2: 113,525,774 probably benign Het
Fmn1 TCC TCCTCCACC 2: 113,525,783 probably benign Homo
Foxd3 GGACCCTACGGCCG GG 4: 99,657,396 probably benign Homo
Frmpd2 G T 14: 33,511,021 L399F probably damaging Homo
Gabre ACTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC ACTCCGGCTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC X: 72,270,042 probably benign Homo
Gbp2b A G 3: 142,603,652 I175V probably benign Het
Gm4340 CAG CAGAAG 10: 104,196,072 probably benign Het
Gm4340 AGC AGCGGC 10: 104,196,082 probably benign Het
Gm5114 T C 7: 39,411,105 R107G probably benign Het
Gm5114 A C 7: 39,411,106 H106Q probably benign Het
Gm9573 T G 17: 35,622,121 probably benign Homo
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
H2-T10 TGTTTCCCACTG T 17: 36,120,281 probably null Het
Hist1h1t GAGAA GA 13: 23,695,920 probably benign Homo
Ifi203 C T 1: 173,928,328 probably benign Het
Ifi208 ATGGTG ATG 1: 173,677,698 probably benign Homo
Ighv5-9 C T 12: 113,661,877 S82N probably benign Homo
Il17rd CGG CGGTGG 14: 27,082,680 probably benign Het
Il2 AGTGG AGTGGGGCTTGAGGTGG 3: 37,125,826 probably benign Het
Ipo9 TCC TCCGCC 1: 135,386,275 probably benign Het
Ipo9 CCT CCTACT 1: 135,386,279 probably null Het
Isg20l2 AAG AAGCAG 3: 87,931,712 probably benign Homo
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,363 probably benign Het
Kmt2c TGCTGCTG TGCTGCTGCTGCTG 5: 25,315,766 probably benign Homo
Krt10 CGCC CGCCGCC 11: 99,386,199 probably benign Het
Krt10 CCTCCT CCTCCTACTCCT 11: 99,389,274 probably benign Het
Las1l GAG GAGCAG X: 95,940,820 probably benign Het
Las1l AGG AGGCGG X: 95,940,821 probably benign Het
Lkaaear1 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCATCTCCAGCTCCAGCTCCAGCTCCA 2: 181,697,579 probably benign Het
Lrch1 A T 14: 74,819,565 C241S possibly damaging Het
Lrit3 G GCTT 3: 129,788,819 probably benign Het
Maml2 GCAGCAGCAACAGCAGCA GCAGCAGCA 9: 13,621,459 probably benign Homo
Mast4 T TTTC 13: 102,734,862 probably benign Het
Med12l AGC AGCGGC 3: 59,275,982 probably benign Het
Noc2l TGC TGCAGC 4: 156,240,096 probably benign Het
Nrg3 G GACATTT 14: 38,397,273 probably benign Homo
Olfr635 TCC TCCC 7: 103,979,903 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Homo
Park2 G A 17: 11,854,763 V323M probably damaging Het
Patl2 GCT GCTTCT 2: 122,126,135 probably benign Het
Pdik1l TTTT TTTTGTTTTTGGTTT 4: 134,279,374 probably null Homo
Pik3c2g AG AGAGGG 6: 139,635,656 probably null Homo
Plekhs1 T TTCAGACCTCCCC 19: 56,479,858 probably benign Het
Prkd3 G T 17: 78,975,820 probably null Homo
Prr13 TCC TCCCCC 15: 102,462,177 probably benign Homo
Prrc2b G A 2: 32,221,167 A1852T probably damaging Homo
Ptms CTT CTTTTT 6: 124,914,458 probably benign Homo
Rtl1 TTCCTCTTCCTCCTC TTCCTC 12: 109,591,198 probably benign Homo
Scaf4 TGCGGC TGC 16: 90,229,854 probably benign Homo
Serac1 T A 17: 6,070,808 K70N probably damaging Homo
Six3 CGG CGGTGG 17: 85,621,368 probably benign Het
Sry GTG GTGCTG Y: 2,662,837 probably benign Homo
Stard8 GGAAGA GGAAGAAGA X: 99,066,505 probably benign Het
Supt20 TTCAGCA TTCAGCATCAGCA 3: 54,727,647 probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Supt20 CAGCAG CAGCAGTAGCAG 3: 54,727,664 probably null Het
Sytl1 CTCT C 4: 133,256,993 probably benign Homo
Tcof1 AGC AGCGGC 18: 60,835,742 probably benign Het
Tdpoz2 T TCA 3: 93,651,615 probably null Homo
Tert GCC GCCAAGGGTTCC 13: 73,648,302 probably benign Homo
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Ticrr ATT ATTTTT 7: 79,694,311 probably benign Homo
Tnfaip8 ACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,046,839 probably null Homo
Tnfrsf9 T TGCC 4: 150,934,395 probably benign Homo
Tob1 GCA GCAACA 11: 94,214,464 probably benign Het
Tob1 CA CAGTA 11: 94,214,477 probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Homo
Triobp TCGTCG TCGTCGTCG 15: 78,993,387 probably benign Homo
Tsen2 AGG AGGGGG 6: 115,560,069 probably benign Het
Ubtf TCC TCCGCC 11: 102,306,956 probably benign Het
Ubtf CTCGTCGTC CTCGTCGTCGTC 11: 102,306,958 probably benign Het
Vars TGG TGGAGTCCTGGGCGG 17: 35,015,989 probably benign Homo
Vmn1r171 C T 7: 23,632,680 A110V probably benign Het
Vmn2r31 G T 7: 7,384,608 Q655K probably damaging Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Homo
Zc3h13 AGATGTGCG AGATGTGCGGGATGTGCG 14: 75,323,603 probably benign Het
Zc3h13 CG CGAGATGTGTG 14: 75,323,610 probably benign Het
Zfp282 GGC GGCCGC 6: 47,904,797 probably benign Het
Zfp384 AGGC AGGCCCAGGCCCCGGC 6: 125,036,493 probably benign Het
Zfp459 TGA TGAGCGA 13: 67,408,274 probably null Homo
Zfp462 GCCACC GCCACCTCAGCCACAACCACC 4: 55,009,757 probably benign Het
Zfp462 CCACC CCACCTCAGCCACAGTCACC 4: 55,009,758 probably benign Het
Zfp598 CACCAC CACCACAACCAC 17: 24,680,775 probably benign Het
Zfp831 CCT CCTGCT 2: 174,645,481 probably benign Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26771005 missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26710275 splice site probably benign
IGL01681:Dnah12 APN 14 26722160 missense probably benign
IGL02082:Dnah12 APN 14 26707162 missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26716577 missense probably benign 0.20
IGL02170:Dnah12 APN 14 26773112 missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26706917 missense probably benign 0.00
IGL02367:Dnah12 APN 14 26709161 missense probably benign 0.30
IGL02418:Dnah12 APN 14 26773722 missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26724512 missense probably benign 0.02
IGL03066:Dnah12 APN 14 26697398 missense probably benign 0.06
F5770:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
FR4340:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26872740 missense probably damaging 1.00
LCD18:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26772644 missense probably damaging 1.00
R0110:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26799999 missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26706117 intron probably null
R0364:Dnah12 UTSW 14 26724473 missense probably benign 0.10
R0469:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26709310 missense probably benign 0.00
R0709:Dnah12 UTSW 14 26884265 splice site probably benign
R0734:Dnah12 UTSW 14 26800013 missense probably benign 0.00
R1273:Dnah12 UTSW 14 26739220 nonsense probably null
R1496:Dnah12 UTSW 14 26710248 missense probably benign
R1503:Dnah12 UTSW 14 26773692 missense probably damaging 1.00
R1535:Dnah12 UTSW 14 26816322 missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26766190 missense probably damaging 1.00
R1682:Dnah12 UTSW 14 26778883 missense possibly damaging 0.71
R1758:Dnah12 UTSW 14 26766114 missense probably benign 0.02
R1826:Dnah12 UTSW 14 26711019 missense probably benign 0.01
R1829:Dnah12 UTSW 14 26773023 missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26800075 missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26697398 missense probably benign 0.06
R1862:Dnah12 UTSW 14 26709257 missense probably benign 0.30
R1913:Dnah12 UTSW 14 26792264 splice site probably null
R1933:Dnah12 UTSW 14 26734495 missense probably damaging 0.98
R2006:Dnah12 UTSW 14 26814459 missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26781528 missense probably null 1.00
R2113:Dnah12 UTSW 14 26766141 missense probably damaging 1.00
R2125:Dnah12 UTSW 14 26724458 nonsense probably null
R2126:Dnah12 UTSW 14 26724458 nonsense probably null
R2207:Dnah12 UTSW 14 26781787 missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26739330 missense probably benign 0.06
R2511:Dnah12 UTSW 14 26769950 missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26693470 missense probably benign 0.04
R2875:Dnah12 UTSW 14 26876950 missense probably benign 0.05
R3551:Dnah12 UTSW 14 26770972 missense probably benign 0.01
R3713:Dnah12 UTSW 14 26812790 missense probably benign
R3729:Dnah12 UTSW 14 26706065 missense probably benign 0.02
R3799:Dnah12 UTSW 14 26770923 missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26710211 missense probably benign 0.00
R3892:Dnah12 UTSW 14 26856616 missense probably benign 0.03
R3921:Dnah12 UTSW 14 26771051 missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26723599 missense probably benign
R4065:Dnah12 UTSW 14 26770448 missense probably benign 0.02
R4113:Dnah12 UTSW 14 26693567 missense probably damaging 0.98
R4249:Dnah12 UTSW 14 26709186 missense possibly damaging 0.70
R4259:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4260:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4348:Dnah12 UTSW 14 26814541 missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26815507 missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26871855 missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26770022 missense probably damaging 0.97
R4523:Dnah12 UTSW 14 26876958 missense possibly damaging 0.83
R4546:Dnah12 UTSW 14 26773014 missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26772594 missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26735758 missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26706839 missense probably benign 0.00
R4727:Dnah12 UTSW 14 26872317 missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26716629 nonsense probably null
R4879:Dnah12 UTSW 14 26718046 critical splice donor site probably null
R4893:Dnah12 UTSW 14 26710170 missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26734570 missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26861805 nonsense probably null
R4939:Dnah12 UTSW 14 26891524 missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26716700 missense probably benign 0.00
R5011:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5013:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5043:Dnah12 UTSW 14 26884190 missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26735697 missense probably benign 0.09
R5122:Dnah12 UTSW 14 26718000 missense probably benign 0.00
R5135:Dnah12 UTSW 14 26770477 missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26850926 nonsense probably null
R5154:Dnah12 UTSW 14 26849363 missense probably benign 0.12
R5206:Dnah12 UTSW 14 26769985 missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26693486 missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26773830 missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26879738 missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26814537 missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26774342 splice site probably null
R5389:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26859299 missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26771050 missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26710269 missense probably benign 0.01
R5681:Dnah12 UTSW 14 26815495 missense probably benign 0.32
R5824:Dnah12 UTSW 14 26770518 critical splice donor site probably null
R5863:Dnah12 UTSW 14 26854921 missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26706884 missense probably benign 0.09
R5912:Dnah12 UTSW 14 26770008 nonsense probably null
R5916:Dnah12 UTSW 14 26706918 missense possibly damaging 0.92
R5941:Dnah12 UTSW 14 26706867 missense probably benign 0.00
R5987:Dnah12 UTSW 14 26886871 missense possibly damaging 0.54
R5992:Dnah12 UTSW 14 26697341 missense probably benign 0.04
R6132:Dnah12 UTSW 14 26717911 missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26875270 missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26773685 missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26861769 missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26710257 missense probably benign 0.03
R6235:Dnah12 UTSW 14 26854804 missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26770482 missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26717974 missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26706834 missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26878051 missense probably benign 0.06
R6480:Dnah12 UTSW 14 26872455 missense probably damaging 1.00
R6530:Dnah12 UTSW 14 26735710 missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26735692 missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26872749 missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26796223 missense probably benign 0.02
R6745:Dnah12 UTSW 14 26707228 missense probably damaging 0.99
R6788:Dnah12 UTSW 14 26801513 missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R6912:Dnah12 UTSW 14 26878079 missense probably damaging 1.00
V7580:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26814480 missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26816288 missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26814645 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGGTTGTGGCTCCAAAGAAAGC -3'
(R):5'- ACACTGATCTTGCTCCCTTGAG -3'

Sequencing Primer
(F):5'- CCTTAGCAGAGACAATGGAGCTTTTG -3'
(R):5'- TCCCTTGAGAGTCCTAGCCAG -3'
Posted On2018-04-05