Incidental Mutation 'FR4304:Triobp'
ID511054
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene NameTRIO and F-actin binding protein
SynonymsEST478828, Mus EST 478828, Tara
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #FR4304 ()
Quality Score214.458
Status Not validated
Chromosome15
Chromosomal Location78947724-79005869 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) TCGTCG to TCGTCGTCG at 78993387 bp
ZygosityHomozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109687] [ENSMUST00000109688] [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000130663] [ENSMUST00000144151] [ENSMUST00000229270]
Predicted Effect probably benign
Transcript: ENSMUST00000109687
SMART Domains Protein: ENSMUSP00000105309
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
coiled coil region 339 377 N/A INTRINSIC
coiled coil region 401 463 N/A INTRINSIC
coiled coil region 497 576 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109688
SMART Domains Protein: ENSMUSP00000105310
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
low complexity region 30 47 N/A INTRINSIC
PH 54 151 6.2e-19 SMART
coiled coil region 324 351 N/A INTRINSIC
coiled coil region 386 424 N/A INTRINSIC
coiled coil region 448 510 N/A INTRINSIC
coiled coil region 544 623 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109689
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109690
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130663
SMART Domains Protein: ENSMUSP00000122988
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144151
SMART Domains Protein: ENSMUSP00000116765
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
PH 1 92 1.04e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230425
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 137 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik CTT CTTTTT 12: 110,668,449 probably benign Homo
1700001K19Rik TTC TTCGTC 12: 110,668,450 probably benign Homo
4930402H24Rik TCC TCCCCC 2: 130,770,748 probably benign Het
4930433I11Rik ACCTC AC 7: 40,993,056 probably benign Het
4930447C04Rik AAGT A 12: 72,881,287 probably benign Homo
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Homo
Acbd4 CAG CAGACTAG 11: 103,104,105 probably null Homo
Ahdc1 CT CTCTT 4: 133,062,759 probably benign Homo
Alpk3 TCT TCTGCT 7: 81,077,762 probably benign Het
Anapc4 C T 5: 52,864,526 T650M probably damaging Homo
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,560,924 probably benign Het
Ankrd35 TAGC TAGCAGC 3: 96,683,847 probably benign Homo
Apc GCCAATAAA GCCAATAAAACCAATAAA 18: 34,281,997 probably benign Het
Apol6 TTGT TTGTCTGT 15: 77,051,436 probably null Het
Arhgap30 TGGCCC TGGCCCTGGCCCAGGCCTTGGCCCCGGCCC 1: 171,405,168 probably benign Het
Arpc1b GCC GCCTGTCC 5: 145,126,791 probably null Het
BC051142 A AGCC 17: 34,460,055 probably benign Het
BC051142 GC GCATC 17: 34,460,077 probably benign Het
Blm CT CTACGT 7: 80,463,773 probably null Homo
Blm TCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCC 7: 80,512,919 probably benign Het
Btnl10 GA GAATA 11: 58,923,930 probably benign Homo
Cacna1f AGG AGGCGG X: 7,620,061 probably benign Het
Calhm3 CG CGG 19: 47,151,896 probably null Homo
Catsper2 C CTTTTACTTTTTA 2: 121,397,542 probably null Homo
Catsper2 CAT CATTAT 2: 121,397,782 probably benign Het
Ccdc15 AC ACTTTCC 9: 37,315,157 probably null Het
Ccdc162 T C 10: 41,556,121 D1792G possibly damaging Het
Ccdc170 CCA CCATCA 10: 4,561,021 probably benign Het
Ccdc73 TAAG T 2: 104,991,840 probably benign Homo
Ccdc85c GCC GCCCCC 12: 108,274,612 probably benign Het
Cd22 C T 7: 30,878,082 R2H possibly damaging Het
Cd80 AGA AGAGGA 16: 38,486,315 probably benign Homo
Cep89 GACT G 7: 35,409,641 probably benign Het
Cfap74 A G 4: 155,415,760 D21G possibly damaging Homo
Cgref1 T TCTA 5: 30,933,780 probably benign Homo
Chd4 GCC GCCACTCCC 6: 125,122,144 probably benign Het
Cnpy3 TCC TCCCCC 17: 46,736,743 probably benign Het
Cnpy3 TCC TCCACC 17: 46,736,746 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,581 probably benign Het
Cntnap1 CCCCAG CCCCAGACCCAG 11: 101,189,589 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Homo
Cpeb4 T TGA 11: 31,927,638 probably benign Homo
Cpne1 AGA AGAGAGA 2: 156,072,025 probably null Homo
Cttnbp2 ATTGCTG ATTGCTGTTGCTG 6: 18,367,458 probably benign Het
Dhx37 CTGG C 5: 125,427,530 probably benign Het
Dhx8 CGAGAC CGAGACGGAGAC 11: 101,738,188 probably benign Homo
Dnah12 G T 14: 26,849,385 G2817V probably damaging Homo
Dst C A 1: 34,200,964 S1798Y probably damaging Het
Eif3a TA TATTTCA 19: 60,775,290 probably benign Homo
Ermn TTC TTCCTC 2: 58,048,078 probably benign Het
Ermn CTT CTTGTT 2: 58,048,086 probably benign Het
Fbxo43 GCCTGT GCCTGTTCCTGT 15: 36,152,094 probably benign Het
Fbxo43 TGTGCC TGTGCCAGTGCC 15: 36,152,097 probably benign Het
Fbxo43 GCCTGT GCCTGTCCCTGT 15: 36,152,100 probably benign Het
Fmn1 TCCTCC TCCTCCCCCTCC 2: 113,525,774 probably benign Het
Fmn1 TCC TCCTCCACC 2: 113,525,783 probably benign Homo
Foxd3 GGACCCTACGGCCG GG 4: 99,657,396 probably benign Homo
Frmpd2 G T 14: 33,511,021 L399F probably damaging Homo
Gabre ACTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC ACTCCGGCTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC X: 72,270,042 probably benign Homo
Gbp2b A G 3: 142,603,652 I175V probably benign Het
Gm4340 CAG CAGAAG 10: 104,196,072 probably benign Het
Gm4340 AGC AGCGGC 10: 104,196,082 probably benign Het
Gm5114 T C 7: 39,411,105 R107G probably benign Het
Gm5114 A C 7: 39,411,106 H106Q probably benign Het
Gm9573 T G 17: 35,622,121 probably benign Homo
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
H2-T10 TGTTTCCCACTG T 17: 36,120,281 probably null Het
Hist1h1t GAGAA GA 13: 23,695,920 probably benign Homo
Ifi203 C T 1: 173,928,328 probably benign Het
Ifi208 ATGGTG ATG 1: 173,677,698 probably benign Homo
Ighv5-9 C T 12: 113,661,877 S82N probably benign Homo
Il17rd CGG CGGTGG 14: 27,082,680 probably benign Het
Il2 AGTGG AGTGGGGCTTGAGGTGG 3: 37,125,826 probably benign Het
Ipo9 TCC TCCGCC 1: 135,386,275 probably benign Het
Ipo9 CCT CCTACT 1: 135,386,279 probably null Het
Isg20l2 AAG AAGCAG 3: 87,931,712 probably benign Homo
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,363 probably benign Het
Kmt2c TGCTGCTG TGCTGCTGCTGCTG 5: 25,315,766 probably benign Homo
Krt10 CGCC CGCCGCC 11: 99,386,199 probably benign Het
Krt10 CCTCCT CCTCCTACTCCT 11: 99,389,274 probably benign Het
Las1l GAG GAGCAG X: 95,940,820 probably benign Het
Las1l AGG AGGCGG X: 95,940,821 probably benign Het
Lkaaear1 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCATCTCCAGCTCCAGCTCCAGCTCCA 2: 181,697,579 probably benign Het
Lrch1 A T 14: 74,819,565 C241S possibly damaging Het
Lrit3 G GCTT 3: 129,788,819 probably benign Het
Maml2 GCAGCAGCAACAGCAGCA GCAGCAGCA 9: 13,621,459 probably benign Homo
Mast4 T TTTC 13: 102,734,862 probably benign Het
Med12l AGC AGCGGC 3: 59,275,982 probably benign Het
Noc2l TGC TGCAGC 4: 156,240,096 probably benign Het
Nrg3 G GACATTT 14: 38,397,273 probably benign Homo
Olfr635 TCC TCCC 7: 103,979,903 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Homo
Park2 G A 17: 11,854,763 V323M probably damaging Het
Patl2 GCT GCTTCT 2: 122,126,135 probably benign Het
Pdik1l TTTT TTTTGTTTTTGGTTT 4: 134,279,374 probably null Homo
Pik3c2g AG AGAGGG 6: 139,635,656 probably null Homo
Plekhs1 T TTCAGACCTCCCC 19: 56,479,858 probably benign Het
Prkd3 G T 17: 78,975,820 probably null Homo
Prr13 TCC TCCCCC 15: 102,462,177 probably benign Homo
Prrc2b G A 2: 32,221,167 A1852T probably damaging Homo
Ptms CTT CTTTTT 6: 124,914,458 probably benign Homo
Rtl1 TTCCTCTTCCTCCTC TTCCTC 12: 109,591,198 probably benign Homo
Scaf4 TGCGGC TGC 16: 90,229,854 probably benign Homo
Serac1 T A 17: 6,070,808 K70N probably damaging Homo
Six3 CGG CGGTGG 17: 85,621,368 probably benign Het
Sry GTG GTGCTG Y: 2,662,837 probably benign Homo
Stard8 GGAAGA GGAAGAAGA X: 99,066,505 probably benign Het
Supt20 TTCAGCA TTCAGCATCAGCA 3: 54,727,647 probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Supt20 CAGCAG CAGCAGTAGCAG 3: 54,727,664 probably null Het
Sytl1 CTCT C 4: 133,256,993 probably benign Homo
Tcof1 AGC AGCGGC 18: 60,835,742 probably benign Het
Tdpoz2 T TCA 3: 93,651,615 probably null Homo
Tert GCC GCCAAGGGTTCC 13: 73,648,302 probably benign Homo
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Ticrr ATT ATTTTT 7: 79,694,311 probably benign Homo
Tnfaip8 ACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,046,839 probably null Homo
Tnfrsf9 T TGCC 4: 150,934,395 probably benign Homo
Tob1 GCA GCAACA 11: 94,214,464 probably benign Het
Tob1 CA CAGTA 11: 94,214,477 probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Homo
Tsen2 AGG AGGGGG 6: 115,560,069 probably benign Het
Ubtf TCC TCCGCC 11: 102,306,956 probably benign Het
Ubtf CTCGTCGTC CTCGTCGTCGTC 11: 102,306,958 probably benign Het
Vars TGG TGGAGTCCTGGGCGG 17: 35,015,989 probably benign Homo
Vmn1r171 C T 7: 23,632,680 A110V probably benign Het
Vmn2r31 G T 7: 7,384,608 Q655K probably damaging Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Homo
Zc3h13 AGATGTGCG AGATGTGCGGGATGTGCG 14: 75,323,603 probably benign Het
Zc3h13 CG CGAGATGTGTG 14: 75,323,610 probably benign Het
Zfp282 GGC GGCCGC 6: 47,904,797 probably benign Het
Zfp384 AGGC AGGCCCAGGCCCCGGC 6: 125,036,493 probably benign Het
Zfp459 TGA TGAGCGA 13: 67,408,274 probably null Homo
Zfp462 GCCACC GCCACCTCAGCCACAACCACC 4: 55,009,757 probably benign Het
Zfp462 CCACC CCACCTCAGCCACAGTCACC 4: 55,009,758 probably benign Het
Zfp598 CACCAC CACCACAACCAC 17: 24,680,775 probably benign Het
Zfp831 CCT CCTGCT 2: 174,645,481 probably benign Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78993368 missense probably damaging 1.00
IGL01904:Triobp APN 15 78967364 missense possibly damaging 0.80
IGL01957:Triobp APN 15 78972647 critical splice donor site probably null
IGL02085:Triobp APN 15 78974297 splice site probably benign
IGL02260:Triobp APN 15 78966362 missense probably benign 0.00
IGL02498:Triobp APN 15 78961043 missense probably benign 0.01
IGL02551:Triobp APN 15 78973489 missense probably benign
IGL02740:Triobp APN 15 78966689 missense probably benign 0.21
IGL02810:Triobp APN 15 79002203 missense possibly damaging 0.95
IGL03063:Triobp APN 15 78990884 missense probably damaging 1.00
FR4340:Triobp UTSW 15 78993390 unclassified probably benign
FR4342:Triobp UTSW 15 78993392 unclassified probably benign
FR4449:Triobp UTSW 15 78993389 unclassified probably benign
FR4548:Triobp UTSW 15 78993387 unclassified probably benign
FR4548:Triobp UTSW 15 78993390 unclassified probably benign
R0276:Triobp UTSW 15 78973676 missense probably benign 0.09
R0309:Triobp UTSW 15 78976540 missense probably damaging 1.00
R0433:Triobp UTSW 15 78968201 missense possibly damaging 0.69
R0464:Triobp UTSW 15 78966986 missense possibly damaging 0.71
R0525:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0665:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0689:Triobp UTSW 15 78959988 nonsense probably null
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1151:Triobp UTSW 15 78966479 missense probably benign 0.00
R1152:Triobp UTSW 15 78966479 missense probably benign 0.00
R1510:Triobp UTSW 15 79003767 missense probably damaging 1.00
R1519:Triobp UTSW 15 78973738 missense probably benign 0.00
R1642:Triobp UTSW 15 79002148 missense probably damaging 1.00
R1732:Triobp UTSW 15 78967228 missense possibly damaging 0.69
R1755:Triobp UTSW 15 78966479 missense probably benign 0.00
R1975:Triobp UTSW 15 78966708 missense probably benign
R2051:Triobp UTSW 15 79004540 missense probably damaging 1.00
R2073:Triobp UTSW 15 78973895 missense probably damaging 0.99
R2260:Triobp UTSW 15 78991440 critical splice donor site probably null
R2351:Triobp UTSW 15 79004580 missense probably benign 0.09
R2902:Triobp UTSW 15 78973418 missense possibly damaging 0.90
R3801:Triobp UTSW 15 78973700 missense probably benign 0.04
R3959:Triobp UTSW 15 79002389 nonsense probably null
R4003:Triobp UTSW 15 78959977 unclassified probably benign
R4084:Triobp UTSW 15 78973671 missense probably benign 0.19
R4482:Triobp UTSW 15 78966563 missense possibly damaging 0.87
R4592:Triobp UTSW 15 78967095 missense probably benign
R4662:Triobp UTSW 15 78993269 missense probably damaging 1.00
R4732:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4733:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4789:Triobp UTSW 15 78991028 missense probably damaging 1.00
R4968:Triobp UTSW 15 78966616 missense probably benign 0.03
R4990:Triobp UTSW 15 78967005 missense probably benign 0.00
R5129:Triobp UTSW 15 78961096 missense probably benign 0.15
R5181:Triobp UTSW 15 78967754 missense probably benign 0.00
R5279:Triobp UTSW 15 78994391 missense possibly damaging 0.66
R5584:Triobp UTSW 15 78968132 missense possibly damaging 0.89
R5601:Triobp UTSW 15 78973633 missense probably damaging 1.00
R5810:Triobp UTSW 15 78968267 missense probably benign 0.07
R5969:Triobp UTSW 15 78967540 missense probably benign 0.05
R6722:Triobp UTSW 15 79001565 missense probably damaging 1.00
R6739:Triobp UTSW 15 78966366 missense possibly damaging 0.77
R6810:Triobp UTSW 15 78966615 missense possibly damaging 0.47
X0026:Triobp UTSW 15 78960023 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AACGCTCTGAGGAAAGACGC -3'
(R):5'- AGGCAGTGCAAAGCTTCAGTC -3'

Sequencing Primer
(F):5'- TGGTTCGAGTCCACGGAC -3'
(R):5'- AAAGCTTCAGTCCCTGTGAG -3'
Posted On2018-04-05