Incidental Mutation 'FR4304:Ankhd1'
ID511074
Institutional Source Beutler Lab
Gene Symbol Ankhd1
Ensembl Gene ENSMUSG00000024483
Gene Nameankyrin repeat and KH domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #FR4304 ()
Quality Score217.468
Status Not validated
Chromosome18
Chromosomal Location36559987-36665917 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) GGCGGC to GGCGGCTGCGGC at 36560924 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]
Predicted Effect probably benign
Transcript: ENSMUST00000006205
SMART Domains Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134146
SMART Domains Protein: ENSMUSP00000122136
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 17 35 N/A INTRINSIC
ANK 140 169 2.11e2 SMART
ANK 173 202 3.31e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142977
SMART Domains Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155329
SMART Domains Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2342 2362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 137 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik CTT CTTTTT 12: 110,668,449 probably benign Homo
1700001K19Rik TTC TTCGTC 12: 110,668,450 probably benign Homo
4930402H24Rik TCC TCCCCC 2: 130,770,748 probably benign Het
4930433I11Rik ACCTC AC 7: 40,993,056 probably benign Het
4930447C04Rik AAGT A 12: 72,881,287 probably benign Homo
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Homo
Acbd4 CAG CAGACTAG 11: 103,104,105 probably null Homo
Ahdc1 CT CTCTT 4: 133,062,759 probably benign Homo
Alpk3 TCT TCTGCT 7: 81,077,762 probably benign Het
Anapc4 C T 5: 52,864,526 T650M probably damaging Homo
Ankrd35 TAGC TAGCAGC 3: 96,683,847 probably benign Homo
Apc GCCAATAAA GCCAATAAAACCAATAAA 18: 34,281,997 probably benign Het
Apol6 TTGT TTGTCTGT 15: 77,051,436 probably null Het
Arhgap30 TGGCCC TGGCCCTGGCCCAGGCCTTGGCCCCGGCCC 1: 171,405,168 probably benign Het
Arpc1b GCC GCCTGTCC 5: 145,126,791 probably null Het
BC051142 A AGCC 17: 34,460,055 probably benign Het
BC051142 GC GCATC 17: 34,460,077 probably benign Het
Blm CT CTACGT 7: 80,463,773 probably null Homo
Blm TCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCC 7: 80,512,919 probably benign Het
Btnl10 GA GAATA 11: 58,923,930 probably benign Homo
Cacna1f AGG AGGCGG X: 7,620,061 probably benign Het
Calhm3 CG CGG 19: 47,151,896 probably null Homo
Catsper2 C CTTTTACTTTTTA 2: 121,397,542 probably null Homo
Catsper2 CAT CATTAT 2: 121,397,782 probably benign Het
Ccdc15 AC ACTTTCC 9: 37,315,157 probably null Het
Ccdc162 T C 10: 41,556,121 D1792G possibly damaging Het
Ccdc170 CCA CCATCA 10: 4,561,021 probably benign Het
Ccdc73 TAAG T 2: 104,991,840 probably benign Homo
Ccdc85c GCC GCCCCC 12: 108,274,612 probably benign Het
Cd22 C T 7: 30,878,082 R2H possibly damaging Het
Cd80 AGA AGAGGA 16: 38,486,315 probably benign Homo
Cep89 GACT G 7: 35,409,641 probably benign Het
Cfap74 A G 4: 155,415,760 D21G possibly damaging Homo
Cgref1 T TCTA 5: 30,933,780 probably benign Homo
Chd4 GCC GCCACTCCC 6: 125,122,144 probably benign Het
Cnpy3 TCC TCCCCC 17: 46,736,743 probably benign Het
Cnpy3 TCC TCCACC 17: 46,736,746 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,581 probably benign Het
Cntnap1 CCCCAG CCCCAGACCCAG 11: 101,189,589 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Homo
Cpeb4 T TGA 11: 31,927,638 probably benign Homo
Cpne1 AGA AGAGAGA 2: 156,072,025 probably null Homo
Cttnbp2 ATTGCTG ATTGCTGTTGCTG 6: 18,367,458 probably benign Het
Dhx37 CTGG C 5: 125,427,530 probably benign Het
Dhx8 CGAGAC CGAGACGGAGAC 11: 101,738,188 probably benign Homo
Dnah12 G T 14: 26,849,385 G2817V probably damaging Homo
Dst C A 1: 34,200,964 S1798Y probably damaging Het
Eif3a TA TATTTCA 19: 60,775,290 probably benign Homo
Ermn TTC TTCCTC 2: 58,048,078 probably benign Het
Ermn CTT CTTGTT 2: 58,048,086 probably benign Het
Fbxo43 GCCTGT GCCTGTTCCTGT 15: 36,152,094 probably benign Het
Fbxo43 TGTGCC TGTGCCAGTGCC 15: 36,152,097 probably benign Het
Fbxo43 GCCTGT GCCTGTCCCTGT 15: 36,152,100 probably benign Het
Fmn1 TCCTCC TCCTCCCCCTCC 2: 113,525,774 probably benign Het
Fmn1 TCC TCCTCCACC 2: 113,525,783 probably benign Homo
Foxd3 GGACCCTACGGCCG GG 4: 99,657,396 probably benign Homo
Frmpd2 G T 14: 33,511,021 L399F probably damaging Homo
Gabre ACTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC ACTCCGGCTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC X: 72,270,042 probably benign Homo
Gbp2b A G 3: 142,603,652 I175V probably benign Het
Gm4340 CAG CAGAAG 10: 104,196,072 probably benign Het
Gm4340 AGC AGCGGC 10: 104,196,082 probably benign Het
Gm5114 T C 7: 39,411,105 R107G probably benign Het
Gm5114 A C 7: 39,411,106 H106Q probably benign Het
Gm9573 T G 17: 35,622,121 probably benign Homo
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
H2-T10 TGTTTCCCACTG T 17: 36,120,281 probably null Het
Hist1h1t GAGAA GA 13: 23,695,920 probably benign Homo
Ifi203 C T 1: 173,928,328 probably benign Het
Ifi208 ATGGTG ATG 1: 173,677,698 probably benign Homo
Ighv5-9 C T 12: 113,661,877 S82N probably benign Homo
Il17rd CGG CGGTGG 14: 27,082,680 probably benign Het
Il2 AGTGG AGTGGGGCTTGAGGTGG 3: 37,125,826 probably benign Het
Ipo9 TCC TCCGCC 1: 135,386,275 probably benign Het
Ipo9 CCT CCTACT 1: 135,386,279 probably null Het
Isg20l2 AAG AAGCAG 3: 87,931,712 probably benign Homo
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,363 probably benign Het
Kmt2c TGCTGCTG TGCTGCTGCTGCTG 5: 25,315,766 probably benign Homo
Krt10 CGCC CGCCGCC 11: 99,386,199 probably benign Het
Krt10 CCTCCT CCTCCTACTCCT 11: 99,389,274 probably benign Het
Las1l GAG GAGCAG X: 95,940,820 probably benign Het
Las1l AGG AGGCGG X: 95,940,821 probably benign Het
Lkaaear1 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCATCTCCAGCTCCAGCTCCAGCTCCA 2: 181,697,579 probably benign Het
Lrch1 A T 14: 74,819,565 C241S possibly damaging Het
Lrit3 G GCTT 3: 129,788,819 probably benign Het
Maml2 GCAGCAGCAACAGCAGCA GCAGCAGCA 9: 13,621,459 probably benign Homo
Mast4 T TTTC 13: 102,734,862 probably benign Het
Med12l AGC AGCGGC 3: 59,275,982 probably benign Het
Noc2l TGC TGCAGC 4: 156,240,096 probably benign Het
Nrg3 G GACATTT 14: 38,397,273 probably benign Homo
Olfr635 TCC TCCC 7: 103,979,903 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Homo
Park2 G A 17: 11,854,763 V323M probably damaging Het
Patl2 GCT GCTTCT 2: 122,126,135 probably benign Het
Pdik1l TTTT TTTTGTTTTTGGTTT 4: 134,279,374 probably null Homo
Pik3c2g AG AGAGGG 6: 139,635,656 probably null Homo
Plekhs1 T TTCAGACCTCCCC 19: 56,479,858 probably benign Het
Prkd3 G T 17: 78,975,820 probably null Homo
Prr13 TCC TCCCCC 15: 102,462,177 probably benign Homo
Prrc2b G A 2: 32,221,167 A1852T probably damaging Homo
Ptms CTT CTTTTT 6: 124,914,458 probably benign Homo
Rtl1 TTCCTCTTCCTCCTC TTCCTC 12: 109,591,198 probably benign Homo
Scaf4 TGCGGC TGC 16: 90,229,854 probably benign Homo
Serac1 T A 17: 6,070,808 K70N probably damaging Homo
Six3 CGG CGGTGG 17: 85,621,368 probably benign Het
Sry GTG GTGCTG Y: 2,662,837 probably benign Homo
Stard8 GGAAGA GGAAGAAGA X: 99,066,505 probably benign Het
Supt20 TTCAGCA TTCAGCATCAGCA 3: 54,727,647 probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Supt20 CAGCAG CAGCAGTAGCAG 3: 54,727,664 probably null Het
Sytl1 CTCT C 4: 133,256,993 probably benign Homo
Tcof1 AGC AGCGGC 18: 60,835,742 probably benign Het
Tdpoz2 T TCA 3: 93,651,615 probably null Homo
Tert GCC GCCAAGGGTTCC 13: 73,648,302 probably benign Homo
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Ticrr ATT ATTTTT 7: 79,694,311 probably benign Homo
Tnfaip8 ACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,046,839 probably null Homo
Tnfrsf9 T TGCC 4: 150,934,395 probably benign Homo
Tob1 GCA GCAACA 11: 94,214,464 probably benign Het
Tob1 CA CAGTA 11: 94,214,477 probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Homo
Triobp TCGTCG TCGTCGTCG 15: 78,993,387 probably benign Homo
Tsen2 AGG AGGGGG 6: 115,560,069 probably benign Het
Ubtf TCC TCCGCC 11: 102,306,956 probably benign Het
Ubtf CTCGTCGTC CTCGTCGTCGTC 11: 102,306,958 probably benign Het
Vars TGG TGGAGTCCTGGGCGG 17: 35,015,989 probably benign Homo
Vmn1r171 C T 7: 23,632,680 A110V probably benign Het
Vmn2r31 G T 7: 7,384,608 Q655K probably damaging Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Homo
Zc3h13 AGATGTGCG AGATGTGCGGGATGTGCG 14: 75,323,603 probably benign Het
Zc3h13 CG CGAGATGTGTG 14: 75,323,610 probably benign Het
Zfp282 GGC GGCCGC 6: 47,904,797 probably benign Het
Zfp384 AGGC AGGCCCAGGCCCCGGC 6: 125,036,493 probably benign Het
Zfp459 TGA TGAGCGA 13: 67,408,274 probably null Homo
Zfp462 GCCACC GCCACCTCAGCCACAACCACC 4: 55,009,757 probably benign Het
Zfp462 CCACC CCACCTCAGCCACAGTCACC 4: 55,009,758 probably benign Het
Zfp598 CACCAC CACCACAACCAC 17: 24,680,775 probably benign Het
Zfp831 CCT CCTGCT 2: 174,645,481 probably benign Het
Other mutations in Ankhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ankhd1 APN 18 36665459 unclassified probably benign
IGL00927:Ankhd1 APN 18 36632072 missense probably benign 0.01
IGL01367:Ankhd1 APN 18 36578643 missense probably benign 0.16
IGL01624:Ankhd1 APN 18 36658013 missense probably damaging 1.00
IGL01725:Ankhd1 APN 18 36648153 missense probably benign 0.04
IGL01767:Ankhd1 APN 18 36648374 missense probably damaging 1.00
IGL02005:Ankhd1 APN 18 36648426 missense probably damaging 1.00
IGL02009:Ankhd1 APN 18 36624661 missense probably damaging 1.00
IGL02246:Ankhd1 APN 18 36656726 missense probably damaging 1.00
IGL02336:Ankhd1 APN 18 36594814 missense probably damaging 0.97
IGL02628:Ankhd1 APN 18 36647703 missense probably benign 0.00
IGL02644:Ankhd1 APN 18 36578775 critical splice donor site probably null
IGL02735:Ankhd1 APN 18 36648546 missense probably benign 0.00
IGL02877:Ankhd1 APN 18 36594823 missense probably damaging 1.00
IGL03129:Ankhd1 APN 18 36658008 nonsense probably null
IGL03163:Ankhd1 APN 18 36647628 missense probably damaging 0.97
IGL03182:Ankhd1 APN 18 36578774 missense probably benign 0.06
IGL03184:Ankhd1 APN 18 36647777 missense probably damaging 1.00
IGL03398:Ankhd1 APN 18 36656837 splice site probably benign
R0051:Ankhd1 UTSW 18 36647188 unclassified probably benign
R0089:Ankhd1 UTSW 18 36640356 missense probably damaging 0.99
R0105:Ankhd1 UTSW 18 36646766 missense probably damaging 1.00
R0149:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0243:Ankhd1 UTSW 18 36634734 missense probably damaging 1.00
R0322:Ankhd1 UTSW 18 36658008 nonsense probably null
R0361:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0389:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0418:Ankhd1 UTSW 18 36634300 missense probably damaging 1.00
R0443:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0540:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0607:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0738:Ankhd1 UTSW 18 36645249 splice site probably benign
R1127:Ankhd1 UTSW 18 36634346 missense probably damaging 1.00
R1434:Ankhd1 UTSW 18 36625159 missense probably benign 0.09
R1742:Ankhd1 UTSW 18 36625265 missense probably damaging 1.00
R1776:Ankhd1 UTSW 18 36647308 missense probably benign 0.17
R1856:Ankhd1 UTSW 18 36644527 missense probably benign 0.00
R1923:Ankhd1 UTSW 18 36648030 missense probably benign 0.08
R2044:Ankhd1 UTSW 18 36645113 missense probably benign 0.31
R2112:Ankhd1 UTSW 18 36641626 missense probably damaging 1.00
R2115:Ankhd1 UTSW 18 36634308 missense probably damaging 1.00
R2136:Ankhd1 UTSW 18 36647621 missense probably benign
R2196:Ankhd1 UTSW 18 36648379 missense probably damaging 1.00
R2291:Ankhd1 UTSW 18 36644333 missense probably benign 0.31
R2305:Ankhd1 UTSW 18 36642926 missense possibly damaging 0.59
R2309:Ankhd1 UTSW 18 36624765 missense probably damaging 1.00
R2519:Ankhd1 UTSW 18 36578543 intron probably null
R2958:Ankhd1 UTSW 18 36634729 missense probably damaging 1.00
R3978:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R3980:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R4159:Ankhd1 UTSW 18 36589540 missense possibly damaging 0.91
R4199:Ankhd1 UTSW 18 36661048 unclassified probably benign
R4323:Ankhd1 UTSW 18 36578633 missense probably damaging 1.00
R4356:Ankhd1 UTSW 18 36643043 nonsense probably null
R4496:Ankhd1 UTSW 18 36560786 missense probably damaging 0.98
R4551:Ankhd1 UTSW 18 36655507 unclassified probably null
R4590:Ankhd1 UTSW 18 36583644 missense probably damaging 1.00
R4667:Ankhd1 UTSW 18 36648021 missense possibly damaging 0.77
R4889:Ankhd1 UTSW 18 36578734 missense probably null 0.00
R4923:Ankhd1 UTSW 18 36589452 missense probably damaging 1.00
R5091:Ankhd1 UTSW 18 36625027 missense possibly damaging 0.68
R5254:Ankhd1 UTSW 18 36656715 missense probably benign 0.05
R5314:Ankhd1 UTSW 18 36561058 splice site probably null
R5336:Ankhd1 UTSW 18 36646716 missense probably damaging 1.00
R5367:Ankhd1 UTSW 18 36589408 missense probably damaging 1.00
R5384:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5385:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5387:Ankhd1 UTSW 18 36634644 missense probably damaging 1.00
R5458:Ankhd1 UTSW 18 36648485 missense probably benign 0.01
R5599:Ankhd1 UTSW 18 36560807 missense probably damaging 0.98
R5659:Ankhd1 UTSW 18 36561050 missense probably damaging 1.00
R5750:Ankhd1 UTSW 18 36624902 missense probably benign 0.00
R5874:Ankhd1 UTSW 18 36640269 missense possibly damaging 0.92
R5894:Ankhd1 UTSW 18 36647524 missense probably damaging 0.99
R5969:Ankhd1 UTSW 18 36600834 missense probably damaging 1.00
R6133:Ankhd1 UTSW 18 36625126 missense possibly damaging 0.77
R6190:Ankhd1 UTSW 18 36611809 missense possibly damaging 0.84
R6247:Ankhd1 UTSW 18 36654146 missense probably benign 0.00
R6512:Ankhd1 UTSW 18 36591456 missense probably damaging 1.00
R6649:Ankhd1 UTSW 18 36600783 unclassified probably null
R6653:Ankhd1 UTSW 18 36600783 unclassified probably null
R6763:Ankhd1 UTSW 18 36642969 missense probably benign 0.31
R6976:Ankhd1 UTSW 18 36648254 missense probably benign 0.00
X0027:Ankhd1 UTSW 18 36624832 missense probably damaging 1.00
X0065:Ankhd1 UTSW 18 36578764 nonsense probably null
X0066:Ankhd1 UTSW 18 36646704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAACCATGCTGACGGAC -3'
(R):5'- TGTCAGAGAACACTGCACC -3'

Sequencing Primer
(F):5'- CTGACGGACAGCGGGGG -3'
(R):5'- TGCGGGTCCAAAGAATTCC -3'
Posted On2018-04-05