Incidental Mutation 'FR4340:Arpc1b'
ID511117
Institutional Source Beutler Lab
Gene Symbol Arpc1b
Ensembl Gene ENSMUSG00000029622
Gene Nameactin related protein 2/3 complex, subunit 1B
SynonymsSOP2Hs, L72, p41-ARC
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #FR4340 ()
Quality Score178.468
Status Not validated
Chromosome5
Chromosomal Location145114215-145130705 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CC to CCTGGTC at 145126792 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031627] [ENSMUST00000085679] [ENSMUST00000136074] [ENSMUST00000141602] [ENSMUST00000196111]
Predicted Effect probably benign
Transcript: ENSMUST00000031627
SMART Domains Protein: ENSMUSP00000031627
Gene: ENSMUSG00000029623

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 28 47 N/A INTRINSIC
low complexity region 52 69 N/A INTRINSIC
Pfam:PP28 84 163 3e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000085679
SMART Domains Protein: ENSMUSP00000082822
Gene: ENSMUSG00000029622

DomainStartEndE-ValueType
Blast:WD40 1 36 4e-14 BLAST
WD40 41 80 1.21e-7 SMART
WD40 85 124 1.54e0 SMART
WD40 130 170 1.56e-1 SMART
WD40 191 230 7.7e-1 SMART
Blast:WD40 233 271 9e-18 BLAST
WD40 317 358 3.55e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129033
Predicted Effect probably benign
Transcript: ENSMUST00000136074
SMART Domains Protein: ENSMUSP00000115022
Gene: ENSMUSG00000029622

DomainStartEndE-ValueType
Pfam:WD40 3 29 2.5e-3 PFAM
WD40 77 121 1.79e-1 SMART
WD40 142 181 7.7e-1 SMART
Blast:WD40 184 222 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138900
Predicted Effect probably null
Transcript: ENSMUST00000138922
SMART Domains Protein: ENSMUSP00000115515
Gene: ENSMUSG00000029622

DomainStartEndE-ValueType
PDB:2P9U|C 2 93 4e-43 PDB
SCOP:d1k8kc_ 35 93 2e-11 SMART
Blast:WD40 50 87 3e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141602
SMART Domains Protein: ENSMUSP00000122340
Gene: ENSMUSG00000029622

DomainStartEndE-ValueType
Blast:WD40 1 36 2e-15 BLAST
PDB:2P9U|C 1 56 2e-33 PDB
SCOP:d1k8kc_ 9 56 2e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144375
Predicted Effect probably null
Transcript: ENSMUST00000196111
SMART Domains Protein: ENSMUSP00000143438
Gene: ENSMUSG00000029622

DomainStartEndE-ValueType
Blast:WD40 1 36 4e-14 BLAST
WD40 41 80 1.21e-7 SMART
WD40 85 124 1.54e0 SMART
WD40 130 170 1.56e-1 SMART
WD40 191 230 7.7e-1 SMART
Blast:WD40 237 275 2e-16 BLAST
WD40 321 362 3.55e1 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 97.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of seven subunits of the human Arp2/3 protein complex. This subunit is a member of the SOP2 family of proteins and is most similar to the protein encoded by gene ARPC1A. The similarity between these two proteins suggests that they both may function as p41 subunit of the human Arp2/3 complex that has been implicated in the control of actin polymerization in cells. It is possible that the p41 subunit is involved in assembling and maintaining the structure of the Arp2/3 complex. Multiple versions of the p41 subunit may adapt the functions of the complex to different cell types or developmental stages. This protein also has a role in centrosomal homeostasis by being an activator and substrate of the Aurora A kinase. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
4930578G10Rik G T 4: 42,761,098 probably benign Het
4932438A13Rik TATTATTAT TATTATTATTATTATCATTATTAT 3: 37,050,752 probably benign Het
7530416G11Rik T A 15: 85,494,307 E45V unknown Homo
A530032D15Rik A C 1: 85,109,351 N6K probably damaging Het
A530064D06Rik GTAGGAAGCTTAG GTAG 17: 48,163,381 probably benign Homo
Arrb2 C T 11: 70,438,671 T269M probably damaging Homo
BC051142 CAG CAGTAG 17: 34,460,060 probably null Het
BC051142 GCA GCATCA 17: 34,460,068 probably benign Het
BC051142 GC GCAAC 17: 34,460,077 probably benign Het
Bcas3 G A 11: 85,509,497 V431I probably benign Homo
Blm ACCT ACCTGCCT 7: 80,463,767 probably benign Het
Blm TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCGCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,907 probably benign Het
Blm TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,910 probably benign Het
Cacna1a ACC ACCGCC 8: 84,638,723 probably benign Het
Cacna1f AGG AGGCGG X: 7,620,067 probably benign Het
Calhm1 CTCTGTGGCTGTGGCTGTGGCTGTG CTCTGTGGCTGTGTCTGTGGCTGTGGCTGTGGCTGTG 19: 47,141,251 probably benign Het
Casz1 ACCACAGCCACAGCCACAGCCAC ACCACAGCCACAGCCAC 4: 148,952,302 probably benign Homo
Cd164 G T 10: 41,521,926 A59S probably benign Het
Cd22 C T 7: 30,878,082 R2H possibly damaging Homo
Cd80 GAA GAAAAA 16: 38,486,316 probably benign Homo
Col2a1 C A 15: 97,988,981 probably null Het
Col6a5 A T 9: 105,934,174 N715K unknown Homo
Crygc A T 1: 65,071,663 F155Y probably benign Het
Cul9 TCC TCCCCC 17: 46,500,853 probably benign Het
Cyp2d11 T TGGGA 15: 82,390,022 probably null Homo
D230025D16Rik G A 8: 105,241,098 G207E probably benign Homo
Dbr1 AGG AGGAGGCGG 9: 99,583,701 probably benign Het
Dnah12 G T 14: 26,849,385 G2817V probably damaging Homo
Dnah8 ACACTGCC AC 17: 30,635,463 probably benign Het
Dthd1 C CTTA 5: 62,843,026 probably benign Homo
Fam166b CAGAG CAG 4: 43,427,384 probably null Homo
Fam45a CT CTTTT 19: 60,814,621 probably benign Homo
Frem3 CT CTTTT 8: 80,615,241 probably benign Homo
Frmpd2 G T 14: 33,511,021 L399F probably damaging Homo
G530012D18Rik CACACAGAGAGAGAGAGAGAGAGAGA CA 1: 85,577,152 probably benign Het
Gbp2b A G 3: 142,603,652 I175V probably benign Het
Gm14393 T C 2: 175,061,634 E160G possibly damaging Het
Gm16519 A AGAAC 17: 70,929,338 probably null Homo
Gm4340 CAG CAGTAG 10: 104,196,075 probably null Het
Gm4340 GCAG GCAACAG 10: 104,196,098 probably benign Het
Gm4340 CAGAAG CAGAAGAAG 10: 104,196,099 probably benign Het
Gpatch11 AGGAAG AGGAAGGGGAAG 17: 78,842,174 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
Ifi208 ATGGTG ATG 1: 173,677,698 probably benign Homo
Ighv5-9 C T 12: 113,661,877 S82N probably benign Homo
Ipo9 TCC TCCCCC 1: 135,386,269 probably benign Het
Ipo9 CTC CTCTTC 1: 135,386,271 probably benign Het
Isg20l2 AAG AAGTAG 3: 87,931,712 probably null Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,363 probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,369 probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,375 probably benign Het
Krt10 CAC CACGAC 11: 99,386,202 probably benign Het
Krt10 ACCG ACCGCCG 11: 99,386,203 probably benign Homo
Krt10 CCTCCT CCTCCTTCTCCT 11: 99,389,274 probably benign Het
Las1l TCCTC TCCTCTACCTC X: 95,940,622 probably benign Het
Lce1a1 C T 3: 92,646,844 G108S unknown Het
Lkaaear1 CCAGCTCCAG CCAGCTCCAGCTGCAGCTCCAG 2: 181,697,594 probably benign Het
Lrit3 CTG CTGTTG 3: 129,788,808 probably benign Het
Mamld1 CAG CAGAAG X: 71,118,846 probably benign Het
Mapk7 TGCTGGCGCTGGTGCTGGCGCTGG TGCTGGCGCTGGCGCTGGTGCTGGCGCTGG 11: 61,490,206 probably benign Het
Mast4 TTTT TTTTATTT 13: 102,734,857 probably null Het
Mast4 GCA GCAGTGTCA 13: 102,736,317 probably benign Homo
Med12l AGC AGCCGC 3: 59,275,985 probably benign Het
Mfsd5 G A 15: 102,281,161 V323I probably benign Het
Nacad GTC GTCAGGATC 11: 6,599,761 probably benign Het
Naip1 A C 13: 100,423,076 M1140R probably benign Het
Nbea TTTA T 3: 56,009,212 probably benign Homo
Nefh ACTTGGCCTCACCTGGGG ACTTGGCCTCACCTGGGGCCTTGGCCTCACCTGGGG 11: 4,941,033 probably benign Het
Nefh GCCTCACCTGGGGACTTGGCCTC GCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,038 probably benign Homo
Nefh CTCACCTGGGGACTTGGCCTC CTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,040 probably benign Homo
Neu1 TCTTCTA T 17: 34,932,558 probably benign Het
Nutf2 G T 8: 105,876,570 D78Y probably damaging Het
Olfr495 A G 7: 108,395,893 T258A probably benign Het
Olfr495 G A 7: 108,395,898 M259I probably benign Het
Olfr513 AT ATGATATT 7: 108,754,954 probably benign Homo
Olfr635 TCC TCCC 7: 103,979,903 probably null Het
Park2 G A 17: 11,854,763 V323M probably damaging Homo
Pdik1l ACCAC ACCACCCCCAC 4: 134,279,512 probably benign Het
Pik3c2g AG AGAGGG 6: 139,635,656 probably null Homo
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Homo
Prag1 C CAGT 8: 36,103,886 probably benign Homo
Pramef25 G A 4: 143,949,742 T264M probably damaging Het
Raet1d A G 10: 22,371,559 Q178R probably benign Het
Serac1 T A 17: 6,070,808 K70N probably damaging Homo
Serpina3i CGG CGGTGG 12: 104,265,164 probably benign Het
Sfswap ACTCAGCCC ACTCAGCCCCCTCAGCCC 5: 129,569,751 probably benign Het
Six3 CGG CGGGGG 17: 85,621,356 probably benign Het
Speer4a C A 5: 26,036,748 E127* probably null Het
Sry GCTGCTGCTGCTG GCTGCTGCTGCTGCTG Y: 2,662,824 probably benign Het
St5 CACCACACTGGGGCAGCCCACACTGGGGCAG CCCCACACTGGGGCAG 7: 109,556,921 probably benign Het
Tbr1 A C 2: 61,806,347 probably benign Het
Tdpoz2 T TCC 3: 93,651,615 probably null Homo
Tdpoz4 GAA GA 3: 93,796,880 probably null Het
Tgoln1 AAG AAGCCTCAG 6: 72,616,351 probably benign Homo
Tmbim7 C T 5: 3,670,064 R100C possibly damaging Het
Tob1 AGC AGCCGC 11: 94,214,454 probably benign Het
Tob1 AGC AGCCGC 11: 94,214,460 probably benign Het
Tob1 CA CAGAA 11: 94,214,477 probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 probably benign Het
Triobp TCGG TCGGCGG 15: 78,993,390 probably benign Homo
Tsen2 AGG AGGGGG 6: 115,560,066 probably benign Homo
Tsen2 AGG AGGGGG 6: 115,560,069 probably benign Homo
Ubtf TCC TCCCCC 11: 102,306,950 probably benign Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Homo
Zc3h13 CGGGATGTGCG CGGGATGTGCGGGATGTGCG 14: 75,323,592 probably benign Homo
Zfp28 G A 7: 6,394,863 G766R probably damaging Het
Zfp384 AAGCCCAGGCCCAGGCCCAGGCCCA AAGCCCAGGCCCAAGCCCAGGCCCAGGCCCAGGCCCA 6: 125,036,463 probably benign Het
Zfp428 G A 7: 24,515,081 D41N probably damaging Homo
Zfp598 CCACAGGC CC 17: 24,679,372 probably benign Het
Zfp598 CCACCA CCACCAACACCA 17: 24,680,783 probably benign Het
Zfp831 TCC TCCCCC 2: 174,645,480 probably benign Het
Zfp933 GCTT GCTTTTCTT 4: 147,825,729 probably null Homo
Zfp936 G A 7: 43,189,489 G127R possibly damaging Het
Other mutations in Arpc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Arpc1b APN 5 145127869 utr 3 prime probably benign
IGL01625:Arpc1b APN 5 145121745 splice site probably null
IGL01859:Arpc1b APN 5 145123730 missense probably damaging 0.98
illusory UTSW 5 145122567 missense probably damaging 1.00
FR4304:Arpc1b UTSW 5 145126791 frame shift probably null
FR4737:Arpc1b UTSW 5 145126787 frame shift probably null
R0110:Arpc1b UTSW 5 145127715 missense probably damaging 1.00
R0245:Arpc1b UTSW 5 145126860 missense probably damaging 1.00
R0469:Arpc1b UTSW 5 145127715 missense probably damaging 1.00
R0652:Arpc1b UTSW 5 145126860 missense probably damaging 1.00
R0827:Arpc1b UTSW 5 145125756 missense probably benign 0.34
R1117:Arpc1b UTSW 5 145125754 missense possibly damaging 0.95
R1453:Arpc1b UTSW 5 145125745 missense probably damaging 1.00
R1895:Arpc1b UTSW 5 145122633 missense probably null 0.99
R1946:Arpc1b UTSW 5 145122633 missense probably null 0.99
R2050:Arpc1b UTSW 5 145125919 missense probably damaging 1.00
R2112:Arpc1b UTSW 5 145123769 missense probably damaging 0.99
R4924:Arpc1b UTSW 5 145126815 missense probably benign 0.02
R6534:Arpc1b UTSW 5 145122567 missense probably damaging 1.00
R6883:Arpc1b UTSW 5 145126929 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGCCCCTACTTGATACATCTAGGG -3'
(R):5'- AGCTCTCAGAGTGGTTCTTAGG -3'

Sequencing Primer
(F):5'- ATTTCCTGGTAGCCCTCAGAGG -3'
(R):5'- TTAGGTCTCTGGAAGCACCTGAC -3'
Posted On2018-04-05