Incidental Mutation 'FR4340:A530064D06Rik'
List |< first << previous [record 26 of 585] next >> last >|
ID511191
Institutional Source Beutler Lab
Gene Symbol A530064D06Rik
Ensembl Gene ENSMUSG00000043939
Gene NameRIKEN cDNA A530064D06 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #FR4340 ()
Quality Score214.458
Status Not validated
Chromosome17
Chromosomal Location48151896-48167270 bp(-) (GRCm38)
Type of Mutationsmall deletion (3 aa in frame mutation)
DNA Base Change (assembly) GTAGGAAGCTTAG to GTAG at 48163381 bp
ZygosityHomozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000055935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027764] [ENSMUST00000053612]
Predicted Effect probably benign
Transcript: ENSMUST00000027764
SMART Domains Protein: ENSMUSP00000027764
Gene: ENSMUSG00000043939

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG 26 122 1.56e-5 SMART
low complexity region 144 158 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053612
SMART Domains Protein: ENSMUSP00000055935
Gene: ENSMUSG00000043939

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG 26 122 1.56e-5 SMART
low complexity region 147 166 N/A INTRINSIC
transmembrane domain 191 213 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 97.8%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
4930578G10Rik G T 4: 42,761,098 probably benign Het
4932438A13Rik TATTATTAT TATTATTATTATTATCATTATTAT 3: 37,050,752 probably benign Het
7530416G11Rik T A 15: 85,494,307 E45V unknown Homo
A530032D15Rik A C 1: 85,109,351 N6K probably damaging Het
Arpc1b CC CCTGGTC 5: 145,126,792 probably null Het
Arrb2 C T 11: 70,438,671 T269M probably damaging Homo
BC051142 CAG CAGTAG 17: 34,460,060 probably null Het
BC051142 GCA GCATCA 17: 34,460,068 probably benign Het
BC051142 GC GCAAC 17: 34,460,077 probably benign Het
Bcas3 G A 11: 85,509,497 V431I probably benign Homo
Blm ACCT ACCTGCCT 7: 80,463,767 probably benign Het
Blm TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCGCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,907 probably benign Het
Blm TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,910 probably benign Het
Cacna1a ACC ACCGCC 8: 84,638,723 probably benign Het
Cacna1f AGG AGGCGG X: 7,620,067 probably benign Het
Calhm1 CTCTGTGGCTGTGGCTGTGGCTGTG CTCTGTGGCTGTGTCTGTGGCTGTGGCTGTGGCTGTG 19: 47,141,251 probably benign Het
Casz1 ACCACAGCCACAGCCACAGCCAC ACCACAGCCACAGCCAC 4: 148,952,302 probably benign Homo
Cd164 G T 10: 41,521,926 A59S probably benign Het
Cd22 C T 7: 30,878,082 R2H possibly damaging Homo
Cd80 GAA GAAAAA 16: 38,486,316 probably benign Homo
Col2a1 C A 15: 97,988,981 probably null Het
Col6a5 A T 9: 105,934,174 N715K unknown Homo
Crygc A T 1: 65,071,663 F155Y probably benign Het
Cul9 TCC TCCCCC 17: 46,500,853 probably benign Het
Cyp2d11 T TGGGA 15: 82,390,022 probably null Homo
D230025D16Rik G A 8: 105,241,098 G207E probably benign Homo
Dbr1 AGG AGGAGGCGG 9: 99,583,701 probably benign Het
Dnah12 G T 14: 26,849,385 G2817V probably damaging Homo
Dnah8 ACACTGCC AC 17: 30,635,463 probably benign Het
Dthd1 C CTTA 5: 62,843,026 probably benign Homo
Fam166b CAGAG CAG 4: 43,427,384 probably null Homo
Fam45a CT CTTTT 19: 60,814,621 probably benign Homo
Frem3 CT CTTTT 8: 80,615,241 probably benign Homo
Frmpd2 G T 14: 33,511,021 L399F probably damaging Homo
G530012D18Rik CACACAGAGAGAGAGAGAGAGAGAGA CA 1: 85,577,152 probably benign Het
Gbp2b A G 3: 142,603,652 I175V probably benign Het
Gm14393 T C 2: 175,061,634 E160G possibly damaging Het
Gm16519 A AGAAC 17: 70,929,338 probably null Homo
Gm4340 CAG CAGTAG 10: 104,196,075 probably null Het
Gm4340 GCAG GCAACAG 10: 104,196,098 probably benign Het
Gm4340 CAGAAG CAGAAGAAG 10: 104,196,099 probably benign Het
Gpatch11 AGGAAG AGGAAGGGGAAG 17: 78,842,174 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
Ifi208 ATGGTG ATG 1: 173,677,698 probably benign Homo
Ighv5-9 C T 12: 113,661,877 S82N probably benign Homo
Ipo9 TCC TCCCCC 1: 135,386,269 probably benign Het
Ipo9 CTC CTCTTC 1: 135,386,271 probably benign Het
Isg20l2 AAG AAGTAG 3: 87,931,712 probably null Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,363 probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,369 probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,375 probably benign Het
Krt10 CAC CACGAC 11: 99,386,202 probably benign Het
Krt10 ACCG ACCGCCG 11: 99,386,203 probably benign Homo
Krt10 CCTCCT CCTCCTTCTCCT 11: 99,389,274 probably benign Het
Las1l TCCTC TCCTCTACCTC X: 95,940,622 probably benign Het
Lce1a1 C T 3: 92,646,844 G108S unknown Het
Lkaaear1 CCAGCTCCAG CCAGCTCCAGCTGCAGCTCCAG 2: 181,697,594 probably benign Het
Lrit3 CTG CTGTTG 3: 129,788,808 probably benign Het
Mamld1 CAG CAGAAG X: 71,118,846 probably benign Het
Mapk7 TGCTGGCGCTGGTGCTGGCGCTGG TGCTGGCGCTGGCGCTGGTGCTGGCGCTGG 11: 61,490,206 probably benign Het
Mast4 TTTT TTTTATTT 13: 102,734,857 probably null Het
Mast4 GCA GCAGTGTCA 13: 102,736,317 probably benign Homo
Med12l AGC AGCCGC 3: 59,275,985 probably benign Het
Mfsd5 G A 15: 102,281,161 V323I probably benign Het
Nacad GTC GTCAGGATC 11: 6,599,761 probably benign Het
Naip1 A C 13: 100,423,076 M1140R probably benign Het
Nbea TTTA T 3: 56,009,212 probably benign Homo
Nefh ACTTGGCCTCACCTGGGG ACTTGGCCTCACCTGGGGCCTTGGCCTCACCTGGGG 11: 4,941,033 probably benign Het
Nefh GCCTCACCTGGGGACTTGGCCTC GCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,038 probably benign Homo
Nefh CTCACCTGGGGACTTGGCCTC CTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,040 probably benign Homo
Neu1 TCTTCTA T 17: 34,932,558 probably benign Het
Nutf2 G T 8: 105,876,570 D78Y probably damaging Het
Olfr495 A G 7: 108,395,893 T258A probably benign Het
Olfr495 G A 7: 108,395,898 M259I probably benign Het
Olfr513 AT ATGATATT 7: 108,754,954 probably benign Homo
Olfr635 TCC TCCC 7: 103,979,903 probably null Het
Park2 G A 17: 11,854,763 V323M probably damaging Homo
Pdik1l ACCAC ACCACCCCCAC 4: 134,279,512 probably benign Het
Pik3c2g AG AGAGGG 6: 139,635,656 probably null Homo
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Homo
Prag1 C CAGT 8: 36,103,886 probably benign Homo
Pramef25 G A 4: 143,949,742 T264M probably damaging Het
Raet1d A G 10: 22,371,559 Q178R probably benign Het
Serac1 T A 17: 6,070,808 K70N probably damaging Homo
Serpina3i CGG CGGTGG 12: 104,265,164 probably benign Het
Sfswap ACTCAGCCC ACTCAGCCCCCTCAGCCC 5: 129,569,751 probably benign Het
Six3 CGG CGGGGG 17: 85,621,356 probably benign Het
Speer4a C A 5: 26,036,748 E127* probably null Het
Sry GCTGCTGCTGCTG GCTGCTGCTGCTGCTG Y: 2,662,824 probably benign Het
St5 CACCACACTGGGGCAGCCCACACTGGGGCAG CCCCACACTGGGGCAG 7: 109,556,921 probably benign Het
Tbr1 A C 2: 61,806,347 probably benign Het
Tdpoz2 T TCC 3: 93,651,615 probably null Homo
Tdpoz4 GAA GA 3: 93,796,880 probably null Het
Tgoln1 AAG AAGCCTCAG 6: 72,616,351 probably benign Homo
Tmbim7 C T 5: 3,670,064 R100C possibly damaging Het
Tob1 AGC AGCCGC 11: 94,214,454 probably benign Het
Tob1 AGC AGCCGC 11: 94,214,460 probably benign Het
Tob1 CA CAGAA 11: 94,214,477 probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 probably benign Het
Triobp TCGG TCGGCGG 15: 78,993,390 probably benign Homo
Tsen2 AGG AGGGGG 6: 115,560,066 probably benign Homo
Tsen2 AGG AGGGGG 6: 115,560,069 probably benign Homo
Ubtf TCC TCCCCC 11: 102,306,950 probably benign Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Homo
Zc3h13 CGGGATGTGCG CGGGATGTGCGGGATGTGCG 14: 75,323,592 probably benign Homo
Zfp28 G A 7: 6,394,863 G766R probably damaging Het
Zfp384 AAGCCCAGGCCCAGGCCCAGGCCCA AAGCCCAGGCCCAAGCCCAGGCCCAGGCCCAGGCCCA 6: 125,036,463 probably benign Het
Zfp428 G A 7: 24,515,081 D41N probably damaging Homo
Zfp598 CCACAGGC CC 17: 24,679,372 probably benign Het
Zfp598 CCACCA CCACCAACACCA 17: 24,680,783 probably benign Het
Zfp831 TCC TCCCCC 2: 174,645,480 probably benign Het
Zfp933 GCTT GCTTTTCTT 4: 147,825,729 probably null Homo
Zfp936 G A 7: 43,189,489 G127R possibly damaging Het
Other mutations in A530064D06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:A530064D06Rik APN 17 48152940 missense probably damaging 0.99
IGL01761:A530064D06Rik APN 17 48152959 missense possibly damaging 0.91
IGL02001:A530064D06Rik APN 17 48166674 missense possibly damaging 0.74
IGL02995:A530064D06Rik APN 17 48163288 missense probably benign 0.23
IGL03109:A530064D06Rik APN 17 48166460 missense probably benign 0.13
FR4589:A530064D06Rik UTSW 17 48163381 small deletion probably benign
IGL02984:A530064D06Rik UTSW 17 48163280 missense probably benign 0.06
R0206:A530064D06Rik UTSW 17 48163318 missense probably benign 0.00
R0206:A530064D06Rik UTSW 17 48163318 missense probably benign 0.00
R0660:A530064D06Rik UTSW 17 48166591 missense probably benign 0.18
R0664:A530064D06Rik UTSW 17 48166591 missense probably benign 0.18
R0671:A530064D06Rik UTSW 17 48166656 missense probably benign 0.05
R1587:A530064D06Rik UTSW 17 48166417 missense probably benign 0.20
R4087:A530064D06Rik UTSW 17 48166510 missense probably damaging 0.96
R4089:A530064D06Rik UTSW 17 48166510 missense probably damaging 0.96
R4963:A530064D06Rik UTSW 17 48163414 missense probably benign 0.34
R5060:A530064D06Rik UTSW 17 48166939 missense probably damaging 1.00
R5083:A530064D06Rik UTSW 17 48166390 missense possibly damaging 0.86
R5219:A530064D06Rik UTSW 17 48163350 missense possibly damaging 0.70
R6175:A530064D06Rik UTSW 17 48152848 missense possibly damaging 0.91
R6189:A530064D06Rik UTSW 17 48167054 start gained probably benign
R6420:A530064D06Rik UTSW 17 48166398 missense probably damaging 1.00
R6439:A530064D06Rik UTSW 17 48166485 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTCATGTCTGATCCTGC -3'
(R):5'- AAACTTGCTTCTTGGATGGCTG -3'

Sequencing Primer
(F):5'- CACATCCTTTCAACACAAGGATG -3'
(R):5'- GGATGGCTGCTTTCATTTTCCTCAG -3'
Posted On2018-04-05