Incidental Mutation 'FR4342:Ifi208'
ID511203
Institutional Source Beutler Lab
Gene Symbol Ifi208
Ensembl Gene ENSMUSG00000066677
Gene Nameinterferon activated gene 208
SynonymsPydc3, E430029J22Rik, Pyr-rv1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #FR4342 ()
Quality Score214.458
Status Not validated
Chromosome1
Chromosomal Location173673675-173698395 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) ATGGTG to ATG at 173677698 bp
ZygosityHomozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085876] [ENSMUST00000169857]
Predicted Effect probably benign
Transcript: ENSMUST00000085876
SMART Domains Protein: ENSMUSP00000083039
Gene: ENSMUSG00000066677

DomainStartEndE-ValueType
PYRIN 10 88 3.23e-20 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
low complexity region 488 504 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169857
SMART Domains Protein: ENSMUSP00000128958
Gene: ENSMUSG00000066677

DomainStartEndE-ValueType
PYRIN 10 88 3.23e-20 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
Pfam:HERV-K_REC 502 580 3.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182880
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 97.8%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik TT TTATGT 8: 124,839,833 probably null Homo
4930402H24Rik TCC TCCCCC 2: 130,770,742 probably benign Het
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Homo
7530416G11Rik T A 15: 85,494,307 E45V unknown Homo
AF366264 G C 8: 13,837,613 H159Q probably benign Het
Ankrd35 TCCCC TCCC 3: 96,683,515 probably null Het
Anxa2 CCC CCCACC 9: 69,480,205 probably benign Het
Anxa2 C CCCA 9: 69,480,210 probably benign Het
Apc CAATAAAGC CAATAAAGCAAATAAAGC 18: 34,281,999 probably benign Homo
Arrb2 C T 11: 70,438,671 T269M probably damaging Homo
Bcas3 G A 11: 85,509,497 V431I probably benign Homo
Begain CCCCGCC CCCCGCCCCCGCC 12: 109,033,418 probably benign Homo
Catsper2 TCA TCAACA 2: 121,397,793 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Homo
Cd22 C T 7: 30,878,082 R2H possibly damaging Homo
Cluh GAGCCT GAGCCTCAGCCT 11: 74,669,524 probably benign Het
Cluh GCCTGA GCCTGAACCTGA 11: 74,669,526 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,575 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Het
Col6a5 A T 9: 105,934,174 N715K unknown Homo
Cpeb4 T TGA 11: 31,927,638 probably benign Homo
D230025D16Rik G A 8: 105,241,098 G207E probably benign Homo
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,680 probably benign Het
Defa29 C G 8: 21,326,144 R69P probably benign Het
Dhx8 CG CGAGAACGG 11: 101,738,206 probably null Het
Dnah12 G T 14: 26,849,385 G2817V probably damaging Homo
Dthd1 C CTTA 5: 62,843,026 probably benign Homo
E4f1 GC GCCCC 17: 24,455,197 probably benign Het
F830016B08Rik A ACAG 18: 60,299,941 probably benign Homo
Fam166b CAGAG CAG 4: 43,427,384 probably null Homo
Fbrsl1 GTGTGTGTGCTGGTGCGTGTGCTGGTG GTGTGTGTGCTGGTGTGTGTGCTGGTGCGTGTGCTGGTG 5: 110,378,125 probably benign Het
Fbxo22 A C 9: 55,221,070 probably null Het
Flg G A 3: 93,290,513 probably benign Het
Fmn1 TCC TCCTCCACC 2: 113,525,783 probably benign Homo
Frmpd2 G T 14: 33,511,021 L399F probably damaging Homo
Gbp2b A G 3: 142,603,652 I175V probably benign Het
Gjc2 T TCCCG 11: 59,182,743 probably benign Homo
Gm13103 AA AATA 4: 143,851,643 probably null Homo
Gm14496 A C 2: 181,995,906 K258Q probably benign Het
Gm4340 CAGAAG CAGAAGAAG 10: 104,196,066 probably benign Het
Gm4340 CAGAAG CAGAAGAAG 10: 104,196,099 probably benign Het
Gm7534 G GCTC 4: 134,202,631 probably benign Homo
Gpatch11 AGAGGA AGAGGATGAGGA 17: 78,842,178 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Homo
Hist1h1t TGTGG TG 13: 23,695,913 probably benign Homo
Hoxa3 G GCTT 6: 52,170,130 probably benign Homo
Ighv5-9 C T 12: 113,661,877 S82N probably benign Homo
Klra10 G A 6: 130,272,747 R192C probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,375 probably benign Het
Krt10 CGCC CGCCGCC 11: 99,386,199 probably benign Het
Krt10 ACC ACCCCC 11: 99,386,203 probably benign Homo
Lce1m CGCTGCTGCTGCCACAGCA C 3: 93,018,247 probably benign Het
Mak16 T G,A 8: 31,161,749 E203D probably benign Homo
Med12l AGC AGCGGC 3: 59,275,988 probably benign Het
Med12l AGCGGC AGCGGCGGC 3: 59,275,994 probably benign Het
Mn1 AGC AGCGGC 5: 111,419,706 probably benign Het
Nacad TC TCAGGGGC 11: 6,599,762 probably benign Het
Naip1 C T 13: 100,425,471 R1062K probably benign Het
Ndel1 G A 11: 68,833,409 P246L probably damaging Het
Nelfe AC ACAAAGAGCGGGATCGAGACAGAGCC 17: 34,854,089 probably benign Het
Olfr495 A G 7: 108,395,893 T258A probably benign Het
Olfr495 G A 7: 108,395,898 M259I probably benign Het
Olfr635 TCC TCCC 7: 103,979,903 probably null Het
P4ha2 GTGTTGCTG GTG 11: 54,110,251 probably benign Homo
Park2 G A 17: 11,854,763 V323M probably damaging Homo
Pde3b GGTGGTGGTG GGTGGTGGTGGTG 7: 114,534,775 probably benign Homo
Pdik1l ACCACC ACCACCCCCACC 4: 134,279,509 probably benign Homo
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Homo
Plekhs1 AGAC AGACCTCCCCCGCGAC 19: 56,479,861 probably benign Homo
Pramef25 G A 4: 143,949,742 T264M probably damaging Het
Pramef25 AAGAG AAG 4: 143,949,757 probably null Het
Ptms TCT TCTCCT 6: 124,914,454 probably benign Homo
Raet1d A G 10: 22,371,559 Q178R probably benign Het
Rtbdn AGCG AGCGCCGGCG 8: 84,956,168 probably benign Het
Rtbdn GC GCAGCGCC 8: 84,956,178 probably benign Het
Serac1 T A 17: 6,070,808 K70N probably damaging Homo
Sfswap CCCACTC CCCACTCAGACCACTC 5: 129,569,757 probably benign Homo
Sp110 ACT ACTGCT 1: 85,587,488 probably benign Het
Spaca1 GCTCTC GCTCTCACTCTC 4: 34,049,838 probably benign Het
Spag17 GGA GGATGA 3: 100,056,249 probably benign Het
Spag17 GGAGGAGGA GGAGGAGGAGGA 3: 100,056,252 probably benign Homo
Speer4a C A 5: 26,036,748 E127* probably null Het
Sry TGG TGGGGG Y: 2,662,835 probably benign Het
Sry GGT GGTTGT Y: 2,662,836 probably benign Het
Sry GGT GGTAGT Y: 2,662,839 probably benign Homo
Sry CTGCTGGTG CTG Y: 2,663,146 probably benign Het
Tdpoz3 C T 3: 93,826,512 P165S probably benign Het
Tdpoz4 GAA GA 3: 93,796,880 probably null Het
Tert AGGCC AGGCCAAGGGGGCC 13: 73,648,300 probably benign Homo
Tmbim7 C T 5: 3,670,064 R100C possibly damaging Homo
Tnfrsf9 CT CTGAT 4: 150,934,394 probably benign Homo
Tob1 AGC AGCCGC 11: 94,214,472 probably benign Het
Trav6n-5 GCTT G 14: 53,104,912 probably benign Homo
Triobp G GTCA 15: 78,993,392 probably benign Homo
Tsen2 AGG AGGTGG 6: 115,560,072 probably benign Het
Ubtf TCC TCCGCC 11: 102,306,956 probably benign Het
Ubtf TC TCCCC 11: 102,306,959 probably benign Het
Vmn2r125 G A 4: 156,350,965 V213I probably benign Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Homo
Zdhhc16 G A 19: 41,942,149 probably benign Het
Zfp28 G A 7: 6,394,863 G766R probably damaging Het
Zfp335 GTCGTC GTCGTCGTC 2: 164,907,465 probably benign Het
Zfp335 C CCCC 2: 164,907,477 probably benign Het
Zfp428 G A 7: 24,515,081 D41N probably damaging Homo
Zfp429 A T 13: 67,396,650 F48Y probably benign Het
Zfp598 CCACC CCACCCACACC 17: 24,680,780 probably benign Het
Zfp93 G A 7: 24,275,586 R332H possibly damaging Het
Other mutations in Ifi208
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ifi208 APN 1 173679038 critical splice donor site probably null
IGL00725:Ifi208 APN 1 173682861 missense possibly damaging 0.86
IGL01952:Ifi208 APN 1 173679031 missense possibly damaging 0.93
IGL02024:Ifi208 APN 1 173683290 missense probably damaging 0.99
IGL02637:Ifi208 APN 1 173678942 missense probably benign 0.15
IGL02829:Ifi208 APN 1 173682840 missense probably damaging 0.99
IGL03216:Ifi208 APN 1 173678941 missense possibly damaging 0.68
IGL03398:Ifi208 APN 1 173683251 missense probably damaging 0.96
FR4304:Ifi208 UTSW 1 173677698 small deletion probably benign
FR4340:Ifi208 UTSW 1 173677698 small deletion probably benign
R0022:Ifi208 UTSW 1 173683046 missense possibly damaging 0.91
R0468:Ifi208 UTSW 1 173683481 missense probably benign 0.08
R0734:Ifi208 UTSW 1 173683335 missense probably damaging 0.98
R0780:Ifi208 UTSW 1 173682696 missense probably benign 0.06
R1070:Ifi208 UTSW 1 173683044 missense probably damaging 0.99
R1339:Ifi208 UTSW 1 173683238 missense probably damaging 0.99
R1473:Ifi208 UTSW 1 173695654 missense possibly damaging 0.53
R1755:Ifi208 UTSW 1 173677910 missense possibly damaging 0.86
R3012:Ifi208 UTSW 1 173695570 critical splice acceptor site probably null
R3692:Ifi208 UTSW 1 173682872 missense possibly damaging 0.93
R4175:Ifi208 UTSW 1 173682701 missense probably benign 0.01
R4235:Ifi208 UTSW 1 173682911 missense probably benign 0.06
R4749:Ifi208 UTSW 1 173695614 missense possibly damaging 0.70
R4815:Ifi208 UTSW 1 173682837 missense probably damaging 0.96
R5116:Ifi208 UTSW 1 173677983 intron probably benign
R5138:Ifi208 UTSW 1 173690673 missense probably null 0.29
R5210:Ifi208 UTSW 1 173683265 missense probably benign
R5304:Ifi208 UTSW 1 173683608 missense probably benign
R6126:Ifi208 UTSW 1 173677708 missense possibly damaging 0.91
R6558:Ifi208 UTSW 1 173683023 missense probably damaging 0.99
R6915:Ifi208 UTSW 1 173682878 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGGCACAGTTAGTAATCATGC -3'
(R):5'- GCTGCAAGTTCTGGAATGTC -3'

Sequencing Primer
(F):5'- AACGCTATGTCAAGGGCT -3'
(R):5'- GCAAGTTCTGGAATGTCTTCAC -3'
Posted On2018-04-05