Incidental Mutation 'FR4342:Cntnap1'
ID511279
Institutional Source Beutler Lab
Gene Symbol Cntnap1
Ensembl Gene ENSMUSG00000017167
Gene Namecontactin associated protein-like 1
SynonymsNrxn4, Caspr, NCP1, p190, paranodin, shm
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.540) question?
Stock #FR4342 ()
Quality Score217.468
Status Not validated
Chromosome11
Chromosomal Location101170523-101190724 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) AGCCCC to AGCCCCCGCCCC at 101189575 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103109] [ENSMUST00000107284] [ENSMUST00000107285]
Predicted Effect probably benign
Transcript: ENSMUST00000103109
SMART Domains Protein: ENSMUSP00000099398
Gene: ENSMUSG00000017167

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FA58C 25 169 7.49e-36 SMART
LamG 196 333 2.86e-32 SMART
LamG 382 516 3.49e-27 SMART
EGF 544 578 2.28e0 SMART
Blast:FBG 580 777 1e-133 BLAST
LamG 806 940 1.95e-25 SMART
EGF_like 961 997 6.03e1 SMART
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1047 1058 N/A INTRINSIC
low complexity region 1063 1078 N/A INTRINSIC
LamG 1081 1219 2.59e-30 SMART
4.1m 1305 1323 7.85e-7 SMART
low complexity region 1333 1370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107284
SMART Domains Protein: ENSMUSP00000102905
Gene: ENSMUSG00000006920

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 4.5e-21 PFAM
SANT 135 263 3.86e1 SMART
low complexity region 369 381 N/A INTRINSIC
SANT 430 478 3.03e-4 SMART
CXC 556 593 8.14e-2 SMART
SET 613 734 7.34e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107285
SMART Domains Protein: ENSMUSP00000102906
Gene: ENSMUSG00000006920

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 42 71 5.1e-20 PFAM
SANT 138 266 3.86e1 SMART
low complexity region 372 384 N/A INTRINSIC
SANT 433 481 3.03e-4 SMART
CXC 559 596 8.14e-2 SMART
SET 616 737 7.34e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138835
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 97.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene product was initially identified as a 190-kD protein associated with the contactin-PTPRZ1 complex. The 1,384-amino acid protein, also designated p190 or CASPR for 'contactin-associated protein,' includes an extracellular domain with several putative protein-protein interaction domains, a putative transmembrane domain, and a 74-amino acid cytoplasmic domain. Northern blot analysis showed that the gene is transcribed predominantly in brain as a transcript of 6.2 kb, with weak expression in several other tissues tested. The architecture of its extracellular domain is similar to that of neurexins, and this protein may be the signaling subunit of contactin, enabling recruitment and activation of intracellular signaling pathways in neurons. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mutant mice exhibit reduced body size and nervous system defects, including impaired balance, hypoactivity, and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik TT TTATGT 8: 124,839,833 probably null Homo
4930402H24Rik TCC TCCCCC 2: 130,770,742 probably benign Het
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Homo
7530416G11Rik T A 15: 85,494,307 E45V unknown Homo
AF366264 G C 8: 13,837,613 H159Q probably benign Het
Ankrd35 TCCCC TCCC 3: 96,683,515 probably null Het
Anxa2 CCC CCCACC 9: 69,480,205 probably benign Het
Anxa2 C CCCA 9: 69,480,210 probably benign Het
Apc CAATAAAGC CAATAAAGCAAATAAAGC 18: 34,281,999 probably benign Homo
Arrb2 C T 11: 70,438,671 T269M probably damaging Homo
Bcas3 G A 11: 85,509,497 V431I probably benign Homo
Begain CCCCGCC CCCCGCCCCCGCC 12: 109,033,418 probably benign Homo
Catsper2 TCA TCAACA 2: 121,397,793 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Homo
Cd22 C T 7: 30,878,082 R2H possibly damaging Homo
Cluh GAGCCT GAGCCTCAGCCT 11: 74,669,524 probably benign Het
Cluh GCCTGA GCCTGAACCTGA 11: 74,669,526 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Het
Col6a5 A T 9: 105,934,174 N715K unknown Homo
Cpeb4 T TGA 11: 31,927,638 probably benign Homo
D230025D16Rik G A 8: 105,241,098 G207E probably benign Homo
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,680 probably benign Het
Defa29 C G 8: 21,326,144 R69P probably benign Het
Dhx8 CG CGAGAACGG 11: 101,738,206 probably null Het
Dnah12 G T 14: 26,849,385 G2817V probably damaging Homo
Dthd1 C CTTA 5: 62,843,026 probably benign Homo
E4f1 GC GCCCC 17: 24,455,197 probably benign Het
F830016B08Rik A ACAG 18: 60,299,941 probably benign Homo
Fam166b CAGAG CAG 4: 43,427,384 probably null Homo
Fbrsl1 GTGTGTGTGCTGGTGCGTGTGCTGGTG GTGTGTGTGCTGGTGTGTGTGCTGGTGCGTGTGCTGGTG 5: 110,378,125 probably benign Het
Fbxo22 A C 9: 55,221,070 probably null Het
Flg G A 3: 93,290,513 probably benign Het
Fmn1 TCC TCCTCCACC 2: 113,525,783 probably benign Homo
Frmpd2 G T 14: 33,511,021 L399F probably damaging Homo
Gbp2b A G 3: 142,603,652 I175V probably benign Het
Gjc2 T TCCCG 11: 59,182,743 probably benign Homo
Gm13103 AA AATA 4: 143,851,643 probably null Homo
Gm14496 A C 2: 181,995,906 K258Q probably benign Het
Gm4340 CAGAAG CAGAAGAAG 10: 104,196,066 probably benign Het
Gm4340 CAGAAG CAGAAGAAG 10: 104,196,099 probably benign Het
Gm7534 G GCTC 4: 134,202,631 probably benign Homo
Gpatch11 AGAGGA AGAGGATGAGGA 17: 78,842,178 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Homo
Hist1h1t TGTGG TG 13: 23,695,913 probably benign Homo
Hoxa3 G GCTT 6: 52,170,130 probably benign Homo
Ifi208 ATGGTG ATG 1: 173,677,698 probably benign Homo
Ighv5-9 C T 12: 113,661,877 S82N probably benign Homo
Klra10 G A 6: 130,272,747 R192C probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,375 probably benign Het
Krt10 CGCC CGCCGCC 11: 99,386,199 probably benign Het
Krt10 ACC ACCCCC 11: 99,386,203 probably benign Homo
Lce1m CGCTGCTGCTGCCACAGCA C 3: 93,018,247 probably benign Het
Mak16 T G,A 8: 31,161,749 E203D probably benign Homo
Med12l AGC AGCGGC 3: 59,275,988 probably benign Het
Med12l AGCGGC AGCGGCGGC 3: 59,275,994 probably benign Het
Mn1 AGC AGCGGC 5: 111,419,706 probably benign Het
Nacad TC TCAGGGGC 11: 6,599,762 probably benign Het
Naip1 C T 13: 100,425,471 R1062K probably benign Het
Ndel1 G A 11: 68,833,409 P246L probably damaging Het
Nelfe AC ACAAAGAGCGGGATCGAGACAGAGCC 17: 34,854,089 probably benign Het
Olfr495 A G 7: 108,395,893 T258A probably benign Het
Olfr495 G A 7: 108,395,898 M259I probably benign Het
Olfr635 TCC TCCC 7: 103,979,903 probably null Het
P4ha2 GTGTTGCTG GTG 11: 54,110,251 probably benign Homo
Park2 G A 17: 11,854,763 V323M probably damaging Homo
Pde3b GGTGGTGGTG GGTGGTGGTGGTG 7: 114,534,775 probably benign Homo
Pdik1l ACCACC ACCACCCCCACC 4: 134,279,509 probably benign Homo
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Homo
Plekhs1 AGAC AGACCTCCCCCGCGAC 19: 56,479,861 probably benign Homo
Pramef25 G A 4: 143,949,742 T264M probably damaging Het
Pramef25 AAGAG AAG 4: 143,949,757 probably null Het
Ptms TCT TCTCCT 6: 124,914,454 probably benign Homo
Raet1d A G 10: 22,371,559 Q178R probably benign Het
Rtbdn AGCG AGCGCCGGCG 8: 84,956,168 probably benign Het
Rtbdn GC GCAGCGCC 8: 84,956,178 probably benign Het
Serac1 T A 17: 6,070,808 K70N probably damaging Homo
Sfswap CCCACTC CCCACTCAGACCACTC 5: 129,569,757 probably benign Homo
Sp110 ACT ACTGCT 1: 85,587,488 probably benign Het
Spaca1 GCTCTC GCTCTCACTCTC 4: 34,049,838 probably benign Het
Spag17 GGA GGATGA 3: 100,056,249 probably benign Het
Spag17 GGAGGAGGA GGAGGAGGAGGA 3: 100,056,252 probably benign Homo
Speer4a C A 5: 26,036,748 E127* probably null Het
Sry TGG TGGGGG Y: 2,662,835 probably benign Het
Sry GGT GGTTGT Y: 2,662,836 probably benign Het
Sry GGT GGTAGT Y: 2,662,839 probably benign Homo
Sry CTGCTGGTG CTG Y: 2,663,146 probably benign Het
Tdpoz3 C T 3: 93,826,512 P165S probably benign Het
Tdpoz4 GAA GA 3: 93,796,880 probably null Het
Tert AGGCC AGGCCAAGGGGGCC 13: 73,648,300 probably benign Homo
Tmbim7 C T 5: 3,670,064 R100C possibly damaging Homo
Tnfrsf9 CT CTGAT 4: 150,934,394 probably benign Homo
Tob1 AGC AGCCGC 11: 94,214,472 probably benign Het
Trav6n-5 GCTT G 14: 53,104,912 probably benign Homo
Triobp G GTCA 15: 78,993,392 probably benign Homo
Tsen2 AGG AGGTGG 6: 115,560,072 probably benign Het
Ubtf TCC TCCGCC 11: 102,306,956 probably benign Het
Ubtf TC TCCCC 11: 102,306,959 probably benign Het
Vmn2r125 G A 4: 156,350,965 V213I probably benign Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Homo
Zdhhc16 G A 19: 41,942,149 probably benign Het
Zfp28 G A 7: 6,394,863 G766R probably damaging Het
Zfp335 GTCGTC GTCGTCGTC 2: 164,907,465 probably benign Het
Zfp335 C CCCC 2: 164,907,477 probably benign Het
Zfp428 G A 7: 24,515,081 D41N probably damaging Homo
Zfp429 A T 13: 67,396,650 F48Y probably benign Het
Zfp598 CCACC CCACCCACACC 17: 24,680,780 probably benign Het
Zfp93 G A 7: 24,275,586 R332H possibly damaging Het
Other mutations in Cntnap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Cntnap1 APN 11 101185092 missense possibly damaging 0.63
IGL00715:Cntnap1 APN 11 101183205 splice site probably benign
IGL00792:Cntnap1 APN 11 101178966 missense probably benign 0.19
IGL01063:Cntnap1 APN 11 101181788 missense probably benign 0.00
IGL01141:Cntnap1 APN 11 101178807 splice site probably benign
IGL02184:Cntnap1 APN 11 101178365 missense probably damaging 0.98
IGL02272:Cntnap1 APN 11 101178316 missense probably damaging 0.99
IGL02281:Cntnap1 APN 11 101182254 missense possibly damaging 0.86
IGL02437:Cntnap1 APN 11 101186851 missense probably damaging 1.00
IGL02456:Cntnap1 APN 11 101178129 missense probably benign 0.31
IGL02966:Cntnap1 APN 11 101184749 missense probably damaging 1.00
IGL03126:Cntnap1 APN 11 101176301 missense probably benign 0.00
IGL03294:Cntnap1 APN 11 101181682 missense possibly damaging 0.94
Penny UTSW 11 101186764 missense probably damaging 0.99
FR4304:Cntnap1 UTSW 11 101189581 unclassified probably benign
FR4304:Cntnap1 UTSW 11 101189589 unclassified probably benign
FR4449:Cntnap1 UTSW 11 101189569 unclassified probably benign
FR4449:Cntnap1 UTSW 11 101189593 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189572 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189579 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189593 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189594 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189566 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189575 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189580 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189581 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189569 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189576 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189582 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189590 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189569 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189572 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189585 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189588 unclassified probably benign
R0329:Cntnap1 UTSW 11 101188309 missense probably damaging 1.00
R0556:Cntnap1 UTSW 11 101183996 missense probably benign
R0586:Cntnap1 UTSW 11 101187014 missense probably damaging 0.97
R0635:Cntnap1 UTSW 11 101183459 missense probably benign 0.05
R0789:Cntnap1 UTSW 11 101181384 splice site probably benign
R1016:Cntnap1 UTSW 11 101177507 missense probably damaging 0.99
R1085:Cntnap1 UTSW 11 101178836 missense probably benign 0.02
R1211:Cntnap1 UTSW 11 101184710 missense probably damaging 1.00
R1466:Cntnap1 UTSW 11 101180360 missense probably damaging 1.00
R1466:Cntnap1 UTSW 11 101180360 missense probably damaging 1.00
R1584:Cntnap1 UTSW 11 101180360 missense probably damaging 1.00
R1689:Cntnap1 UTSW 11 101188873 unclassified probably null
R1758:Cntnap1 UTSW 11 101184623 missense probably damaging 1.00
R1779:Cntnap1 UTSW 11 101186511 missense probably damaging 0.99
R1964:Cntnap1 UTSW 11 101178024 nonsense probably null
R1966:Cntnap1 UTSW 11 101180386 missense possibly damaging 0.89
R2070:Cntnap1 UTSW 11 101182979 missense probably damaging 1.00
R2088:Cntnap1 UTSW 11 101182547 missense probably damaging 1.00
R2118:Cntnap1 UTSW 11 101188657 missense probably benign
R3795:Cntnap1 UTSW 11 101186764 missense probably damaging 0.99
R4375:Cntnap1 UTSW 11 101182253 missense probably damaging 1.00
R4779:Cntnap1 UTSW 11 101178072 missense possibly damaging 0.91
R4832:Cntnap1 UTSW 11 101183019 missense probably damaging 1.00
R4965:Cntnap1 UTSW 11 101177425 missense possibly damaging 0.52
R4981:Cntnap1 UTSW 11 101176333 splice site probably null
R5008:Cntnap1 UTSW 11 101188741 nonsense probably null
R5399:Cntnap1 UTSW 11 101183316 missense probably benign
R5507:Cntnap1 UTSW 11 101183477 missense probably benign 0.42
R5560:Cntnap1 UTSW 11 101182435 missense probably damaging 1.00
R5589:Cntnap1 UTSW 11 101185118 missense probably benign
R6038:Cntnap1 UTSW 11 101184636 missense probably benign 0.12
R6038:Cntnap1 UTSW 11 101184636 missense probably benign 0.12
R6242:Cntnap1 UTSW 11 101182538 missense probably damaging 1.00
R6306:Cntnap1 UTSW 11 101184615 missense probably damaging 1.00
R6392:Cntnap1 UTSW 11 101186646 missense probably damaging 1.00
R6803:Cntnap1 UTSW 11 101177234 missense possibly damaging 0.81
R6939:Cntnap1 UTSW 11 101186511 missense probably damaging 0.99
R6944:Cntnap1 UTSW 11 101182904 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCCATTCAGTTTTGGTGGCC -3'
(R):5'- TGAACAGAGCCTGCTTAGAAG -3'

Sequencing Primer
(F):5'- GTGGCCTTCCTGCTGCTG -3'
(R):5'- CTTAGAAGAGCCAAATGTCCCTGG -3'
Posted On2018-04-05