Incidental Mutation 'FR4342:Ubtf'
ID511282
Institutional Source Beutler Lab
Gene Symbol Ubtf
Ensembl Gene ENSMUSG00000020923
Gene Nameupstream binding transcription factor, RNA polymerase I
SynonymsA930005G04Rik, UBF1, Tcfubf, UBF
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.972) question?
Stock #FR4342 ()
Quality Score217.468
Status Not validated
Chromosome11
Chromosomal Location102304560-102319742 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) TC to TCCCC at 102306959 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006754] [ENSMUST00000079589] [ENSMUST00000107115] [ENSMUST00000107117] [ENSMUST00000107119] [ENSMUST00000107123] [ENSMUST00000146896] [ENSMUST00000173870] [ENSMUST00000174302] [ENSMUST00000178839]
Predicted Effect probably benign
Transcript: ENSMUST00000006754
SMART Domains Protein: ENSMUSP00000006754
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 6e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 640 661 N/A INTRINSIC
low complexity region 677 705 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079589
SMART Domains Protein: ENSMUSP00000078539
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107115
SMART Domains Protein: ENSMUSP00000102732
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107117
SMART Domains Protein: ENSMUSP00000102734
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107119
SMART Domains Protein: ENSMUSP00000102736
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107123
SMART Domains Protein: ENSMUSP00000102740
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146896
SMART Domains Protein: ENSMUSP00000134665
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 1e-34 BLAST
HMG 83 151 2.09e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173870
SMART Domains Protein: ENSMUSP00000133611
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174302
SMART Domains Protein: ENSMUSP00000133844
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174726
Predicted Effect probably benign
Transcript: ENSMUST00000178839
SMART Domains Protein: ENSMUSP00000136310
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 97.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HMG-box DNA-binding protein family. The encoded protein plays a critical role in ribosomal RNA transcription as a key component of the pre-initiation complex, mediating the recruitment of RNA polymerase I to rDNA promoter regions. The encoded protein may also play important roles in chromatin remodeling and pre-rRNA processing, and its activity is regulated by both phosphorylation and acetylation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Pseudogenes of this gene are located on the short arm of chromosomes 3, 11 and X and the long arm of chromosome 11. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before implantation with embryonic growth arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik TT TTATGT 8: 124,839,833 probably null Homo
4930402H24Rik TCC TCCCCC 2: 130,770,742 probably benign Het
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Homo
7530416G11Rik T A 15: 85,494,307 E45V unknown Homo
AF366264 G C 8: 13,837,613 H159Q probably benign Het
Ankrd35 TCCCC TCCC 3: 96,683,515 probably null Het
Anxa2 CCC CCCACC 9: 69,480,205 probably benign Het
Anxa2 C CCCA 9: 69,480,210 probably benign Het
Apc CAATAAAGC CAATAAAGCAAATAAAGC 18: 34,281,999 probably benign Homo
Arrb2 C T 11: 70,438,671 T269M probably damaging Homo
Bcas3 G A 11: 85,509,497 V431I probably benign Homo
Begain CCCCGCC CCCCGCCCCCGCC 12: 109,033,418 probably benign Homo
Catsper2 TCA TCAACA 2: 121,397,793 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Homo
Cd22 C T 7: 30,878,082 R2H possibly damaging Homo
Cluh GAGCCT GAGCCTCAGCCT 11: 74,669,524 probably benign Het
Cluh GCCTGA GCCTGAACCTGA 11: 74,669,526 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,575 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Het
Col6a5 A T 9: 105,934,174 N715K unknown Homo
Cpeb4 T TGA 11: 31,927,638 probably benign Homo
D230025D16Rik G A 8: 105,241,098 G207E probably benign Homo
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,680 probably benign Het
Defa29 C G 8: 21,326,144 R69P probably benign Het
Dhx8 CG CGAGAACGG 11: 101,738,206 probably null Het
Dnah12 G T 14: 26,849,385 G2817V probably damaging Homo
Dthd1 C CTTA 5: 62,843,026 probably benign Homo
E4f1 GC GCCCC 17: 24,455,197 probably benign Het
F830016B08Rik A ACAG 18: 60,299,941 probably benign Homo
Fam166b CAGAG CAG 4: 43,427,384 probably null Homo
Fbrsl1 GTGTGTGTGCTGGTGCGTGTGCTGGTG GTGTGTGTGCTGGTGTGTGTGCTGGTGCGTGTGCTGGTG 5: 110,378,125 probably benign Het
Fbxo22 A C 9: 55,221,070 probably null Het
Flg G A 3: 93,290,513 probably benign Het
Fmn1 TCC TCCTCCACC 2: 113,525,783 probably benign Homo
Frmpd2 G T 14: 33,511,021 L399F probably damaging Homo
Gbp2b A G 3: 142,603,652 I175V probably benign Het
Gjc2 T TCCCG 11: 59,182,743 probably benign Homo
Gm13103 AA AATA 4: 143,851,643 probably null Homo
Gm14496 A C 2: 181,995,906 K258Q probably benign Het
Gm4340 CAGAAG CAGAAGAAG 10: 104,196,066 probably benign Het
Gm4340 CAGAAG CAGAAGAAG 10: 104,196,099 probably benign Het
Gm7534 G GCTC 4: 134,202,631 probably benign Homo
Gpatch11 AGAGGA AGAGGATGAGGA 17: 78,842,178 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Homo
Hist1h1t TGTGG TG 13: 23,695,913 probably benign Homo
Hoxa3 G GCTT 6: 52,170,130 probably benign Homo
Ifi208 ATGGTG ATG 1: 173,677,698 probably benign Homo
Ighv5-9 C T 12: 113,661,877 S82N probably benign Homo
Klra10 G A 6: 130,272,747 R192C probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,375 probably benign Het
Krt10 CGCC CGCCGCC 11: 99,386,199 probably benign Het
Krt10 ACC ACCCCC 11: 99,386,203 probably benign Homo
Lce1m CGCTGCTGCTGCCACAGCA C 3: 93,018,247 probably benign Het
Mak16 T G,A 8: 31,161,749 E203D probably benign Homo
Med12l AGC AGCGGC 3: 59,275,988 probably benign Het
Med12l AGCGGC AGCGGCGGC 3: 59,275,994 probably benign Het
Mn1 AGC AGCGGC 5: 111,419,706 probably benign Het
Nacad TC TCAGGGGC 11: 6,599,762 probably benign Het
Naip1 C T 13: 100,425,471 R1062K probably benign Het
Ndel1 G A 11: 68,833,409 P246L probably damaging Het
Nelfe AC ACAAAGAGCGGGATCGAGACAGAGCC 17: 34,854,089 probably benign Het
Olfr495 A G 7: 108,395,893 T258A probably benign Het
Olfr495 G A 7: 108,395,898 M259I probably benign Het
Olfr635 TCC TCCC 7: 103,979,903 probably null Het
P4ha2 GTGTTGCTG GTG 11: 54,110,251 probably benign Homo
Park2 G A 17: 11,854,763 V323M probably damaging Homo
Pde3b GGTGGTGGTG GGTGGTGGTGGTG 7: 114,534,775 probably benign Homo
Pdik1l ACCACC ACCACCCCCACC 4: 134,279,509 probably benign Homo
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Homo
Plekhs1 AGAC AGACCTCCCCCGCGAC 19: 56,479,861 probably benign Homo
Pramef25 G A 4: 143,949,742 T264M probably damaging Het
Pramef25 AAGAG AAG 4: 143,949,757 probably null Het
Ptms TCT TCTCCT 6: 124,914,454 probably benign Homo
Raet1d A G 10: 22,371,559 Q178R probably benign Het
Rtbdn AGCG AGCGCCGGCG 8: 84,956,168 probably benign Het
Rtbdn GC GCAGCGCC 8: 84,956,178 probably benign Het
Serac1 T A 17: 6,070,808 K70N probably damaging Homo
Sfswap CCCACTC CCCACTCAGACCACTC 5: 129,569,757 probably benign Homo
Sp110 ACT ACTGCT 1: 85,587,488 probably benign Het
Spaca1 GCTCTC GCTCTCACTCTC 4: 34,049,838 probably benign Het
Spag17 GGA GGATGA 3: 100,056,249 probably benign Het
Spag17 GGAGGAGGA GGAGGAGGAGGA 3: 100,056,252 probably benign Homo
Speer4a C A 5: 26,036,748 E127* probably null Het
Sry TGG TGGGGG Y: 2,662,835 probably benign Het
Sry GGT GGTTGT Y: 2,662,836 probably benign Het
Sry GGT GGTAGT Y: 2,662,839 probably benign Homo
Sry CTGCTGGTG CTG Y: 2,663,146 probably benign Het
Tdpoz3 C T 3: 93,826,512 P165S probably benign Het
Tdpoz4 GAA GA 3: 93,796,880 probably null Het
Tert AGGCC AGGCCAAGGGGGCC 13: 73,648,300 probably benign Homo
Tmbim7 C T 5: 3,670,064 R100C possibly damaging Homo
Tnfrsf9 CT CTGAT 4: 150,934,394 probably benign Homo
Tob1 AGC AGCCGC 11: 94,214,472 probably benign Het
Trav6n-5 GCTT G 14: 53,104,912 probably benign Homo
Triobp G GTCA 15: 78,993,392 probably benign Homo
Tsen2 AGG AGGTGG 6: 115,560,072 probably benign Het
Vmn2r125 G A 4: 156,350,965 V213I probably benign Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Homo
Zdhhc16 G A 19: 41,942,149 probably benign Het
Zfp28 G A 7: 6,394,863 G766R probably damaging Het
Zfp335 GTCGTC GTCGTCGTC 2: 164,907,465 probably benign Het
Zfp335 C CCCC 2: 164,907,477 probably benign Het
Zfp428 G A 7: 24,515,081 D41N probably damaging Homo
Zfp429 A T 13: 67,396,650 F48Y probably benign Het
Zfp598 CCACC CCACCCACACC 17: 24,680,780 probably benign Het
Zfp93 G A 7: 24,275,586 R332H possibly damaging Het
Other mutations in Ubtf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Ubtf APN 11 102308884 splice site probably benign
IGL02168:Ubtf APN 11 102314168 missense probably damaging 0.99
IGL02218:Ubtf APN 11 102306700 nonsense probably null
FR4304:Ubtf UTSW 11 102306956 small insertion probably benign
FR4304:Ubtf UTSW 11 102306958 small insertion probably benign
FR4340:Ubtf UTSW 11 102306950 small insertion probably benign
FR4342:Ubtf UTSW 11 102306956 small insertion probably benign
FR4449:Ubtf UTSW 11 102306948 nonsense probably null
FR4548:Ubtf UTSW 11 102306958 small insertion probably benign
FR4589:Ubtf UTSW 11 102306943 small insertion probably benign
FR4589:Ubtf UTSW 11 102306945 small insertion probably benign
FR4737:Ubtf UTSW 11 102306948 nonsense probably null
FR4737:Ubtf UTSW 11 102306950 small insertion probably benign
FR4976:Ubtf UTSW 11 102306959 small insertion probably benign
R0919:Ubtf UTSW 11 102309777 splice site probably benign
R1023:Ubtf UTSW 11 102311450 missense possibly damaging 0.93
R1641:Ubtf UTSW 11 102310931 missense probably damaging 1.00
R1678:Ubtf UTSW 11 102308978 missense probably benign 0.01
R1780:Ubtf UTSW 11 102314918 missense probably damaging 1.00
R2406:Ubtf UTSW 11 102308702 nonsense probably null
R4574:Ubtf UTSW 11 102306765 unclassified probably benign
R4986:Ubtf UTSW 11 102314174 missense probably benign 0.03
R5057:Ubtf UTSW 11 102307087 missense probably damaging 0.96
R5217:Ubtf UTSW 11 102308302 missense probably null 0.91
R5221:Ubtf UTSW 11 102307990 nonsense probably null
R5532:Ubtf UTSW 11 102308959 missense probably benign 0.00
R5634:Ubtf UTSW 11 102310324 missense probably damaging 1.00
R6185:Ubtf UTSW 11 102314023 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCGAAGAGTCCCCTGAG -3'
(R):5'- AACATGACCAAGCTCCGAGG -3'

Sequencing Primer
(F):5'- TCATTCTGGGAGAATAAAGACCC -3'
(R):5'- GAGGCCCAAACCCCAAGTCTAG -3'
Posted On2018-04-05