Incidental Mutation 'FR4589:Supt20'
Institutional Source Beutler Lab
Gene Symbol Supt20
Ensembl Gene ENSMUSG00000027751
Gene Namesuppressor of Ty 20
SynonymsFam48a, p38IP, D3Ertd300e, p38 interacting protein
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #FR4589 ()
Quality Score217.468
Status Not validated
Chromosomal Location54692807-54728766 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) GCAGCA to GCAGCATCAGCA at 54727651 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029315] [ENSMUST00000029316] [ENSMUST00000153224] [ENSMUST00000154787] [ENSMUST00000197502] [ENSMUST00000199674] [ENSMUST00000200439] [ENSMUST00000200441]
Predicted Effect probably benign
Transcript: ENSMUST00000029315
SMART Domains Protein: ENSMUSP00000029315
Gene: ENSMUSG00000027751

low complexity region 65 78 N/A INTRINSIC
low complexity region 107 159 N/A INTRINSIC
coiled coil region 201 230 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029316
SMART Domains Protein: ENSMUSP00000029316
Gene: ENSMUSG00000027752

Pfam:RNase_PH 31 166 2.3e-29 PFAM
Pfam:RNase_PH_C 191 258 8.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150923
Predicted Effect probably benign
Transcript: ENSMUST00000153224
SMART Domains Protein: ENSMUSP00000118780
Gene: ENSMUSG00000027752

Pfam:RNase_PH 31 130 2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154787
SMART Domains Protein: ENSMUSP00000115876
Gene: ENSMUSG00000027752

Pfam:RNase_PH 19 106 5.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197502
SMART Domains Protein: ENSMUSP00000143750
Gene: ENSMUSG00000027751

low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 62 227 1.9e-43 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 512 532 N/A INTRINSIC
low complexity region 574 587 N/A INTRINSIC
low complexity region 632 680 N/A INTRINSIC
coiled coil region 722 751 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199674
SMART Domains Protein: ENSMUSP00000142948
Gene: ENSMUSG00000027751

low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 3.3e-39 PFAM
low complexity region 424 442 N/A INTRINSIC
low complexity region 466 475 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200439
SMART Domains Protein: ENSMUSP00000143059
Gene: ENSMUSG00000027751

low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 2.7e-42 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200441
SMART Domains Protein: ENSMUSP00000143231
Gene: ENSMUSG00000027751

low complexity region 65 78 N/A INTRINSIC
low complexity region 123 171 N/A INTRINSIC
coiled coil region 213 242 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.4%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: The incompletely penetrant homozygous phenotype of a splice-site mutation may include retinal epithelium expansion over the dorsal half of the eye, exencephaly, spina bifida, gastrulation defects and/or aberrant somite and mesoderm development. A few mutants survive postnatally and appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 124 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik TCC TCCCCC 2: 130,770,745 probably benign Het
4930402H24Rik CC CCTGC 2: 130,770,752 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
7530416G11Rik T A 15: 85,494,307 E45V unknown Homo
A530064D06Rik GTAGGAAGCTTAG GTAG 17: 48,163,381 probably benign Homo
Anxa2 C CCCA 9: 69,480,210 probably benign Het
Apol6 GTTT GTTTTTTT 15: 77,051,438 probably null Het
Arrb2 C T 11: 70,438,671 T269M probably damaging Homo
AY761185 CACTGTGGG C 8: 20,943,903 probably null Het
BC051142 GCA GCACCA 17: 34,460,053 probably benign Het
BC051142 AGC AGCCGC 17: 34,460,073 probably benign Het
Bcas3 G A 11: 85,509,497 V431I probably benign Homo
Blm TACC TACCGACC 7: 80,463,770 probably null Het
Btnl10 AGA AGAGGA 11: 58,923,929 probably benign Homo
Btnl4 T A 17: 34,472,636 K293M probably benign Het
Catsper2 TGTC TGTCGTC 2: 121,397,779 probably benign Het
Cd109 ATTTAT ATTTATTTATTTCTTTAT 9: 78,712,529 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Homo
Cd22 C T 7: 30,878,082 R2H possibly damaging Homo
Chd4 C T 6: 125,122,133 P1597L probably benign Homo
Chga AGC AGCTGC 12: 102,561,402 probably benign Het
Cluh AGCC AGCCTGGGCC 11: 74,669,531 probably benign Het
Cnpy3 ACCC ACCCCCC 17: 46,736,739 probably benign Het
Cntnap1 CCCAGC CCCAGCTCCAGC 11: 101,189,566 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,575 probably benign Het
Cntnap1 CAGCCC CAGCCCGAGCCC 11: 101,189,580 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,581 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Het
Col6a5 A T 9: 105,934,174 N715K unknown Homo
Cttnbp2 ATT ATTTCTGTT 6: 18,367,458 probably benign Het
D230025D16Rik G A 8: 105,241,098 G207E probably benign Homo
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,677 probably benign Het
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,680 probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,683 probably benign Het
Dbr1 GGAGGA GGAGGAAGAGGA 9: 99,583,696 probably benign Het
Dclre1a AGGCTTTG AG 19: 56,544,123 probably benign Het
Dcpp1 A C 17: 23,881,454 K53Q probably benign Het
Dhx8 CGAGAC CGAGACAGAGAC 11: 101,738,188 probably benign Homo
Dnah12 G T 14: 26,849,385 G2817V probably damaging Homo
Dthd1 C CTT 5: 62,843,026 probably null Homo
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Eps8 AC ACTCGC 6: 137,517,069 probably null Het
Ermn TTC TTCATC 2: 58,048,069 probably benign Het
Fam81b TC TCTCC 13: 76,271,323 probably benign Het
Fbrsl1 TG TGCGTGTGCTGGCG 5: 110,378,150 probably benign Het
Fbxo43 GCCTGT GCCTGTTCCTGT 15: 36,152,100 probably benign Het
Fbxo43 CCTGTG CCTGTGTCTGTG 15: 36,152,101 probably benign Het
Fmn1 CTCCTC CTCCTCTTCCTC 2: 113,525,773 probably benign Het
Fmn1 TCCTCC TCCTCCCCCTCC 2: 113,525,774 probably benign Het
Frmpd2 G T 14: 33,511,021 L399F probably damaging Homo
Gbp2b A G 3: 142,603,652 I175V probably benign Het
Gm10324 G A 13: 66,122,208 S396N probably benign Het
Gm4340 CAG CAGTAG 10: 104,196,078 probably null Het
Gm4340 AGC AGCCGC 10: 104,196,079 probably benign Het
Gm4340 AG AGCCG 10: 104,196,100 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
Ighv5-9 C T 12: 113,661,877 S82N probably benign Homo
Ipo9 CCATC CCATCATC 1: 135,386,266 probably benign Het
Ipo9 TCC TCCCCC 1: 135,386,281 probably benign Het
Isg20l2 GAAA GAAAAAA 3: 87,931,717 probably benign Homo
Klra9 C G 6: 130,182,403 D216H probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,586,361 probably benign Het
Kmt2b CCTCCT CCTCCTACTCCT 7: 30,586,364 probably null Het
Kmt2b TCC TCCTCCGCC 7: 30,586,381 probably benign Het
Krt10 TCC TCCGCCGCC 11: 99,389,276 probably benign Het
Las1l TCTTCC TCTTCCGCTTCC X: 95,940,619 probably benign Het
Las1l TTCCTCCTCCTC TTCCTC X: 95,940,621 probably benign Het
Las1l TC TCTTCCAC X: 95,940,625 probably benign Het
Lce1m TGCTGCCACC TGCTGCCACCACGGCTGCCACC 3: 93,018,268 probably benign Homo
Lor GCCGCCGCC GC 3: 92,081,894 probably null Het
Lrit3 AC ACATCC 3: 129,803,913 probably null Het
Mapk7 GG GGTGCTAG 11: 61,490,222 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Nacad GGGTCA GGGTCATGGTCA 11: 6,599,753 probably benign Het
Ndufc2 G C 7: 97,400,290 M34I probably benign Het
Nphp3 CACG C 9: 104,025,939 probably benign Het
Nrg3 AG AGCCTTTG 14: 38,397,266 probably benign Het
Pdik1l TTTTTGTTTT TTTTTGTTTTGATTTTGTTTT 4: 134,279,368 probably null Homo
Pdik1l TTTTGTTTT TTTTGTTTTGTGTTTGTTTT 4: 134,279,369 probably null Homo
Plekhs1 AC ACCTCCCCCGAGGC 19: 56,479,863 probably benign Het
Prag1 CCGC CCGCCGC 8: 36,103,883 probably benign Homo
Prtg G A 9: 72,856,865 R540Q probably damaging Het
Raet1d T TCCTCTCTGGTAG 10: 22,370,918 probably null Homo
Rhbdf1 A ATTTT 11: 32,214,391 probably benign Het
Rps19 AAAATT AAAATTGAAATT 7: 24,889,182 probably benign Het
Rtbdn GGCAGC GGCAGCCGCAGC 8: 84,956,171 probably benign Het
Scaf4 TGCGGC TGC 16: 90,229,854 probably benign Homo
Serac1 T A 17: 6,070,808 K70N probably damaging Homo
Shf TCT TCTGCT 2: 122,354,177 probably benign Homo
Shroom4 TGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCA X: 6,624,061 probably benign Homo
Six3 CGG CGGAGG 17: 85,621,365 probably benign Het
Snx1 TCT TCTCCT 9: 66,104,926 probably benign Homo
Spag17 AGG AGGGGG 3: 100,056,245 probably benign Het
Spag17 GGA GGATGA 3: 100,056,258 probably benign Het
Speer4a C A 5: 26,036,748 E127* probably null Het
Sry ACTG ACTGCTG Y: 2,662,818 probably benign Het
Tcof1 GGGTA G 18: 60,828,650 probably benign Homo
Tert C CAAGGGTGCG 13: 73,648,304 probably benign Het
Tmbim7 C T 5: 3,670,064 R100C possibly damaging Het
Tmed6 C CTAGA 8: 107,061,598 probably null Homo
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Tob1 CA CAGCAA 11: 94,214,477 probably null Het
Trcg1 AGCTCCTGTGTCTGT A 9: 57,242,202 probably null Homo
Trim16 A AAGC 11: 62,820,695 probably benign Homo
Tubgcp4 GTGA G 2: 121,175,463 probably benign Het
Tusc1 ACCGCC ACCGCCCCCGCC 4: 93,335,307 probably benign Het
Ubtf CTCTTC CTCTTCTTC 11: 102,306,943 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Vars GTGG GTGGAGTCCTGGTTGG 17: 35,015,988 probably benign Homo
Vmn2r52 C T 7: 10,159,020 E731K probably damaging Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Homo
Zc3h13 CGGGATGTGCG CGGGATGTGCGGGATGTGCG 14: 75,323,592 probably benign Homo
Zc3h13 TGTGCGAG TGTGCGAGGAGTGCGAG 14: 75,323,597 probably benign Het
Zc3h13 GTGCGAGAT GTGCGAGATTTGCGAGAT 14: 75,323,598 probably benign Het
Zfhx3 CAGCA CAGCAACAGAAGCA 8: 108,956,101 probably benign Het
Zfp282 GGC GGCAGC 6: 47,904,791 probably benign Het
Zfp459 GA GAGTTA 13: 67,408,275 probably null Homo
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,779 probably benign Het
Zfp831 TCC TCCCCC 2: 174,645,468 probably benign Het
Other mutations in Supt20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Supt20 APN 3 54715169 missense probably damaging 0.98
IGL01781:Supt20 APN 3 54695205 start codon destroyed probably null 0.47
IGL02510:Supt20 APN 3 54715524 intron probably benign
IGL02656:Supt20 APN 3 54708395 missense probably damaging 1.00
IGL02958:Supt20 APN 3 54713723 intron probably benign
IGL03036:Supt20 APN 3 54709302 nonsense probably null
IGL03128:Supt20 APN 3 54708287 missense probably benign 0.05
IGL03164:Supt20 APN 3 54713188 missense probably benign 0.01
FR4304:Supt20 UTSW 3 54727647 small insertion probably benign
FR4304:Supt20 UTSW 3 54727662 small insertion probably benign
FR4304:Supt20 UTSW 3 54727664 nonsense probably null
FR4449:Supt20 UTSW 3 54727649 small insertion probably benign
FR4548:Supt20 UTSW 3 54727657 small insertion probably benign
FR4548:Supt20 UTSW 3 54727664 small insertion probably benign
FR4548:Supt20 UTSW 3 54727673 small insertion probably benign
FR4589:Supt20 UTSW 3 54727655 small insertion probably benign
FR4589:Supt20 UTSW 3 54727671 small insertion probably benign
FR4737:Supt20 UTSW 3 54727657 small insertion probably benign
FR4737:Supt20 UTSW 3 54727658 small insertion probably benign
FR4737:Supt20 UTSW 3 54727661 small insertion probably benign
R0383:Supt20 UTSW 3 54703149 nonsense probably null
R0675:Supt20 UTSW 3 54706969 missense probably damaging 1.00
R0744:Supt20 UTSW 3 54714701 missense probably damaging 1.00
R0968:Supt20 UTSW 3 54708400 intron probably benign
R1075:Supt20 UTSW 3 54706941 nonsense probably null
R1689:Supt20 UTSW 3 54712162 nonsense probably null
R1772:Supt20 UTSW 3 54710420 missense probably damaging 1.00
R1779:Supt20 UTSW 3 54714743 missense probably benign 0.00
R1829:Supt20 UTSW 3 54727658 utr 3 prime probably benign
R3236:Supt20 UTSW 3 54709080 missense possibly damaging 0.94
R3237:Supt20 UTSW 3 54709080 missense possibly damaging 0.94
R4989:Supt20 UTSW 3 54695134 utr 5 prime probably benign
R5180:Supt20 UTSW 3 54709085 missense probably benign 0.00
R5188:Supt20 UTSW 3 54710428 missense possibly damaging 0.87
R5423:Supt20 UTSW 3 54709325 missense probably damaging 1.00
R5627:Supt20 UTSW 3 54713190 missense possibly damaging 0.86
R5888:Supt20 UTSW 3 54712207 missense probably benign
R5995:Supt20 UTSW 3 54709053 missense probably damaging 0.97
R6316:Supt20 UTSW 3 54727648 small insertion probably benign
R6623:Supt20 UTSW 3 54718294 missense possibly damaging 0.93
R6713:Supt20 UTSW 3 54698601 missense possibly damaging 0.89
R6874:Supt20 UTSW 3 54727754 intron probably null
R6988:Supt20 UTSW 3 54698597 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2018-04-05