Incidental Mutation 'FR4589:Lrit3'
ID511331
Institutional Source Beutler Lab
Gene Symbol Lrit3
Ensembl Gene ENSMUSG00000093865
Gene Nameleucine-rich repeat, immunoglobulin-like and transmembrane domains 3
SynonymsLOC242235
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #FR4589 ()
Quality Score217.637
Status Not validated
Chromosome3
Chromosomal Location129787881-129804030 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AC to ACATCC at 129803913 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029648] [ENSMUST00000171313] [ENSMUST00000179187] [ENSMUST00000185462] [ENSMUST00000196902] [ENSMUST00000200079]
Predicted Effect probably benign
Transcript: ENSMUST00000029648
SMART Domains Protein: ENSMUSP00000029648
Gene: ENSMUSG00000028012

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 36 309 3.5e-11 PFAM
Pfam:7tm_1 42 294 1.5e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171313
SMART Domains Protein: ENSMUSP00000132360
Gene: ENSMUSG00000028012

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 36 309 3.5e-11 PFAM
Pfam:7tm_1 42 294 4.6e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000179187
SMART Domains Protein: ENSMUSP00000136912
Gene: ENSMUSG00000093865

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 20 61 2.7e-1 SMART
LRR 80 103 6.96e0 SMART
LRR 104 127 3.27e1 SMART
LRR_TYP 128 151 4.47e-3 SMART
LRR_TYP 152 175 7.37e-4 SMART
LRRCT 201 252 4.65e-2 SMART
Blast:IG 260 297 9e-13 BLAST
low complexity region 298 311 N/A INTRINSIC
FN3 364 443 1.85e0 SMART
transmembrane domain 462 484 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000185462
SMART Domains Protein: ENSMUSP00000140184
Gene: ENSMUSG00000093865

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 20 61 1.3e-3 SMART
LRR 80 103 2.9e-2 SMART
LRR 104 127 1.4e-1 SMART
LRR_TYP 128 151 1.9e-5 SMART
LRR_TYP 152 175 3.2e-6 SMART
LRRCT 201 252 2.3e-4 SMART
IGc2 266 335 4.7e-11 SMART
low complexity region 340 352 N/A INTRINSIC
low complexity region 362 376 N/A INTRINSIC
low complexity region 408 432 N/A INTRINSIC
FN3 485 564 9e-3 SMART
transmembrane domain 583 605 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196317
Predicted Effect probably benign
Transcript: ENSMUST00000196902
SMART Domains Protein: ENSMUSP00000143093
Gene: ENSMUSG00000028012

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 36 309 3.5e-11 PFAM
Pfam:7tm_1 42 294 1.5e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197535
Predicted Effect probably benign
Transcript: ENSMUST00000200079
SMART Domains Protein: ENSMUSP00000143054
Gene: ENSMUSG00000028012

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7tm_1 30 197 3.1e-22 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.4%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a fibronectin type III domain and a C-terminal transmembrane domain, as well as a leucine-rich repeat domain and immunoglobulin-like domain near the N-terminus. The encoded protein may regulate fibroblast growth factor receptors and affect the modification of these receptors, which are glycosylated differently in the Golgi and endoplasmic reticulum. Mutations in this gene are associated with congenital stationary night blindness, type 1F. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a targeted allele show a selective absence of the ERG b-wave with a normal a-wave component under scotopic conditions, as well as variable ERG responses with larger a-wave amplitudes, shorter b-wave amplitudes, and longer implicit times of both waves under photopic conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik TCC TCCCCC 2: 130,770,745 probably benign Het
4930402H24Rik CC CCTGC 2: 130,770,752 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
7530416G11Rik T A 15: 85,494,307 E45V unknown Homo
A530064D06Rik GTAGGAAGCTTAG GTAG 17: 48,163,381 probably benign Homo
Anxa2 C CCCA 9: 69,480,210 probably benign Het
Apol6 GTTT GTTTTTTT 15: 77,051,438 probably null Het
Arrb2 C T 11: 70,438,671 T269M probably damaging Homo
AY761185 CACTGTGGG C 8: 20,943,903 probably null Het
BC051142 GCA GCACCA 17: 34,460,053 probably benign Het
BC051142 AGC AGCCGC 17: 34,460,073 probably benign Het
Bcas3 G A 11: 85,509,497 V431I probably benign Homo
Blm TACC TACCGACC 7: 80,463,770 probably null Het
Btnl10 AGA AGAGGA 11: 58,923,929 probably benign Homo
Btnl4 T A 17: 34,472,636 K293M probably benign Het
Catsper2 TGTC TGTCGTC 2: 121,397,779 probably benign Het
Cd109 ATTTAT ATTTATTTATTTCTTTAT 9: 78,712,529 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Homo
Cd22 C T 7: 30,878,082 R2H possibly damaging Homo
Chd4 C T 6: 125,122,133 P1597L probably benign Homo
Chd4 CCCCTGCCCCTGCCACTGCCCCTGCC CCCCTGCCCCTGCCCCTGCCACTGCCCCTGCC 6: 125,122,139 probably benign Homo
Chga AGC AGCTGC 12: 102,561,402 probably benign Het
Cluh AGCC AGCCTGGGCC 11: 74,669,531 probably benign Het
Cnpy3 ACCC ACCCCCC 17: 46,736,739 probably benign Het
Cntnap1 CCCAGC CCCAGCTCCAGC 11: 101,189,566 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,575 probably benign Het
Cntnap1 CAGCCC CAGCCCGAGCCC 11: 101,189,580 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,581 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Het
Col6a5 A T 9: 105,934,174 N715K unknown Homo
Cttnbp2 ATT ATTTCTGTT 6: 18,367,458 probably benign Het
D230025D16Rik G A 8: 105,241,098 G207E probably benign Homo
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,677 probably benign Het
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,680 probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,683 probably benign Het
Dbr1 GGAGGA GGAGGAAGAGGA 9: 99,583,696 probably benign Het
Dclre1a AGGCTTTG AG 19: 56,544,123 probably benign Het
Dcpp1 A C 17: 23,881,454 K53Q probably benign Het
Dhx8 CGAGAC CGAGACAGAGAC 11: 101,738,188 probably benign Homo
Dnah12 G T 14: 26,849,385 G2817V probably damaging Homo
Dthd1 C CTT 5: 62,843,026 probably null Homo
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Eps8 AC ACTCGC 6: 137,517,069 probably null Het
Ermn TTC TTCATC 2: 58,048,069 probably benign Het
Fam81b TC TCTCC 13: 76,271,323 probably benign Het
Fbrsl1 TG TGCGTGTGCTGGCG 5: 110,378,150 probably benign Het
Fbxo43 GCCTGT GCCTGTTCCTGT 15: 36,152,100 probably benign Het
Fbxo43 CCTGTG CCTGTGTCTGTG 15: 36,152,101 probably benign Het
Fmn1 CTCCTC CTCCTCTTCCTC 2: 113,525,773 probably benign Het
Fmn1 TCCTCC TCCTCCCCCTCC 2: 113,525,774 probably benign Het
Frmpd2 G T 14: 33,511,021 L399F probably damaging Homo
Gabre GCTCCGACTCCGACTCCG GCTCCGACTCCGACTCCGACTCCG X: 72,270,030 probably benign Homo
Gabre ACTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC ACTCCGGCTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC X: 72,270,042 probably benign Homo
Gbp2b A G 3: 142,603,652 I175V probably benign Het
Gm10324 G A 13: 66,122,208 S396N probably benign Het
Gm4340 CAG CAGTAG 10: 104,196,078 probably null Het
Gm4340 AGC AGCCGC 10: 104,196,079 probably benign Het
Gm4340 AG AGCCG 10: 104,196,100 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
Ighv5-9 C T 12: 113,661,877 S82N probably benign Homo
Ipo9 CCATC CCATCATC 1: 135,386,266 probably benign Het
Ipo9 TCC TCCCCC 1: 135,386,281 probably benign Het
Isg20l2 GAAA GAAAAAA 3: 87,931,717 probably benign Homo
Klra9 C G 6: 130,182,403 D216H probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,586,361 probably benign Het
Kmt2b CCTCCT CCTCCTACTCCT 7: 30,586,364 probably null Het
Kmt2b TCC TCCTCCGCC 7: 30,586,381 probably benign Het
Krt10 TCC TCCGCCGCC 11: 99,389,276 probably benign Het
Las1l TCTTCC TCTTCCGCTTCC X: 95,940,619 probably benign Het
Las1l TTCCTCCTCCTC TTCCTC X: 95,940,621 probably benign Het
Las1l TC TCTTCCAC X: 95,940,625 probably benign Het
Lce1m TGCTGCCACC TGCTGCCACCACGGCTGCCACC 3: 93,018,268 probably benign Homo
Lor GCCGCCGCC GC 3: 92,081,894 probably null Het
Lrrc63 CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 14: 75,125,182 probably benign Homo
Mapk7 GG GGTGCTAG 11: 61,490,222 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Nacad GGGTCA GGGTCATGGTCA 11: 6,599,753 probably benign Het
Ndufc2 G C 7: 97,400,290 M34I probably benign Het
Nphp3 CACG C 9: 104,025,939 probably benign Het
Nrg3 AG AGCCTTTG 14: 38,397,266 probably benign Het
Pdik1l TTTTTGTTTT TTTTTGTTTTGATTTTGTTTT 4: 134,279,368 probably null Homo
Pdik1l TTTTGTTTT TTTTGTTTTGTGTTTGTTTT 4: 134,279,369 probably null Homo
Plekhs1 AC ACCTCCCCCGAGGC 19: 56,479,863 probably benign Het
Prag1 CCGC CCGCCGC 8: 36,103,883 probably benign Homo
Prtg G A 9: 72,856,865 R540Q probably damaging Het
Raet1d T TCCTCTCTGGTAG 10: 22,370,918 probably null Homo
Rhbdf1 A ATTTT 11: 32,214,391 probably benign Het
Rps19 AAAATT AAAATTGAAATT 7: 24,889,182 probably benign Het
Rtbdn GGCAGC GGCAGCCGCAGC 8: 84,956,171 probably benign Het
Scaf4 TGCGGC TGC 16: 90,229,854 probably benign Homo
Serac1 T A 17: 6,070,808 K70N probably damaging Homo
Setd1a CTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CTGGTGGTGGTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,785,297 probably benign Het
Shf TCT TCTGCT 2: 122,354,177 probably benign Homo
Shroom4 TGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCA X: 6,624,061 probably benign Homo
Six3 CGG CGGAGG 17: 85,621,365 probably benign Het
Snx1 TCT TCTCCT 9: 66,104,926 probably benign Homo
Spag17 AGG AGGGGG 3: 100,056,245 probably benign Het
Spag17 GGA GGATGA 3: 100,056,258 probably benign Het
Speer4a C A 5: 26,036,748 E127* probably null Het
Sry ACTG ACTGCTG Y: 2,662,818 probably benign Het
Supt20 GCAGCA GCAGCATCAGCA 3: 54,727,651 probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,655 probably benign Het
Supt20 A AGCAGCT 3: 54,727,671 probably benign Het
Tcof1 GGGTA G 18: 60,828,650 probably benign Homo
Tert C CAAGGGTGCG 13: 73,648,304 probably benign Het
Tmbim7 C T 5: 3,670,064 R100C possibly damaging Het
Tmed6 C CTAGA 8: 107,061,598 probably null Homo
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Tob1 CA CAGCAA 11: 94,214,477 probably null Het
Trcg1 AGCTCCTGTGTCTGT A 9: 57,242,202 probably null Homo
Trim16 A AAGC 11: 62,820,695 probably benign Homo
Tubgcp4 GTGA G 2: 121,175,463 probably benign Het
Tusc1 ACCGCC ACCGCCCCCGCC 4: 93,335,307 probably benign Het
Ubtf CTCTTC CTCTTCTTC 11: 102,306,943 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Vars GTGG GTGGAGTCCTGGTTGG 17: 35,015,988 probably benign Homo
Vmn2r52 C T 7: 10,159,020 E731K probably damaging Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Homo
Zc3h13 CGGGATGTGCG CGGGATGTGCGGGATGTGCG 14: 75,323,592 probably benign Homo
Zc3h13 TGTGCGAG TGTGCGAGGAGTGCGAG 14: 75,323,597 probably benign Het
Zc3h13 GTGCGAGAT GTGCGAGATTTGCGAGAT 14: 75,323,598 probably benign Het
Zfhx3 CAGCA CAGCAACAGAAGCA 8: 108,956,101 probably benign Het
Zfp282 GGC GGCAGC 6: 47,904,791 probably benign Het
Zfp459 GA GAGTTA 13: 67,408,275 probably null Homo
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,779 probably benign Het
Zfp831 TCC TCCCCC 2: 174,645,468 probably benign Het
Other mutations in Lrit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Lrit3 UTSW 3 129788819 small insertion probably benign
FR4340:Lrit3 UTSW 3 129788808 small insertion probably benign
FR4548:Lrit3 UTSW 3 129788813 small insertion probably benign
FR4548:Lrit3 UTSW 3 129788816 small insertion probably benign
FR4737:Lrit3 UTSW 3 129788806 small insertion probably benign
FR4737:Lrit3 UTSW 3 129788810 small insertion probably benign
FR4737:Lrit3 UTSW 3 129803913 frame shift probably null
FR4976:Lrit3 UTSW 3 129803910 unclassified probably benign
R0555:Lrit3 UTSW 3 129791296 missense probably damaging 1.00
R0629:Lrit3 UTSW 3 129788302 missense probably damaging 1.00
R0631:Lrit3 UTSW 3 129788555 missense probably damaging 1.00
R1690:Lrit3 UTSW 3 129800745 missense probably damaging 0.99
R1902:Lrit3 UTSW 3 129791246 missense probably benign 0.17
R1955:Lrit3 UTSW 3 129800481 missense probably benign 0.11
R3155:Lrit3 UTSW 3 129791395 missense probably benign 0.00
R4005:Lrit3 UTSW 3 129791372 missense probably benign 0.14
R4445:Lrit3 UTSW 3 129788531 nonsense probably null
R4675:Lrit3 UTSW 3 129788472 missense probably damaging 1.00
R5104:Lrit3 UTSW 3 129788391 missense possibly damaging 0.86
R5147:Lrit3 UTSW 3 129803925 missense possibly damaging 0.78
R5271:Lrit3 UTSW 3 129788301 missense probably damaging 1.00
R5505:Lrit3 UTSW 3 129791438 missense possibly damaging 0.83
R5587:Lrit3 UTSW 3 129788898 missense probably benign 0.25
R6056:Lrit3 UTSW 3 129789355 missense probably damaging 1.00
R6239:Lrit3 UTSW 3 129800346 missense probably damaging 0.98
R6280:Lrit3 UTSW 3 129788763 missense probably damaging 0.99
R6305:Lrit3 UTSW 3 129800460 missense probably damaging 0.98
R6441:Lrit3 UTSW 3 129800360 missense probably benign
R6947:Lrit3 UTSW 3 129789234 missense probably benign 0.01
R6949:Lrit3 UTSW 3 129789285 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCCGTGTGAGGCTTCTG -3'
(R):5'- ATTCGTGGTAGCTTCCCCATG -3'

Sequencing Primer
(F):5'- CTGAGAGGTAAGTGTTGCCC -3'
(R):5'- GTGGTAGCTTCCCCATGTTCTTG -3'
Posted On2018-04-05