Incidental Mutation 'FR4589:Kmt2b'
ID511350
Institutional Source Beutler Lab
Gene Symbol Kmt2b
Ensembl Gene ENSMUSG00000006307
Gene Namelysine (K)-specific methyltransferase 2B
Synonyms2610014H22Rik, Wbp7, Mll2
Accession Numbers

Genbank: NM_029274; MGI: 109565

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #FR4589 ()
Quality Score217.468
Status Not validated
Chromosome7
Chromosomal Location30568858-30588726 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CCTCCT to CCTCCTGCTCCT at 30586361 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000006470] [ENSMUST00000108150] [ENSMUST00000108151] [ENSMUST00000108154]
Predicted Effect probably benign
Transcript: ENSMUST00000006470
SMART Domains Protein: ENSMUSP00000006470
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 7.2e-15 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1881 1899 N/A INTRINSIC
low complexity region 1912 1942 N/A INTRINSIC
low complexity region 1961 1978 N/A INTRINSIC
low complexity region 1991 2003 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2048 2061 N/A INTRINSIC
low complexity region 2087 2105 N/A INTRINSIC
low complexity region 2127 2138 N/A INTRINSIC
low complexity region 2215 2235 N/A INTRINSIC
low complexity region 2239 2270 N/A INTRINSIC
low complexity region 2396 2406 N/A INTRINSIC
FYRC 2419 2504 4.83e-36 SMART
SET 2581 2703 1.67e-42 SMART
PostSET 2705 2721 4.65e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108150
SMART Domains Protein: ENSMUSP00000103785
Gene: ENSMUSG00000006310

DomainStartEndE-ValueType
ZnF_C2H2 14 36 1.67e-2 SMART
ZnF_C2H2 41 63 2.4e-3 SMART
low complexity region 81 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108151
SMART Domains Protein: ENSMUSP00000103786
Gene: ENSMUSG00000006310

DomainStartEndE-ValueType
BTB 29 117 1.67e-8 SMART
low complexity region 207 222 N/A INTRINSIC
ZnF_C2H2 350 372 1.28e-3 SMART
ZnF_C2H2 378 400 1.67e-2 SMART
ZnF_C2H2 405 427 2.4e-3 SMART
low complexity region 445 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108154
SMART Domains Protein: ENSMUSP00000103789
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 1e-14 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1872 1890 N/A INTRINSIC
low complexity region 1903 1933 N/A INTRINSIC
low complexity region 1952 1969 N/A INTRINSIC
low complexity region 1982 1994 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2039 2052 N/A INTRINSIC
low complexity region 2078 2096 N/A INTRINSIC
low complexity region 2118 2129 N/A INTRINSIC
low complexity region 2206 2226 N/A INTRINSIC
low complexity region 2230 2261 N/A INTRINSIC
low complexity region 2383 2398 N/A INTRINSIC
FYRC 2411 2496 4.83e-36 SMART
SET 2573 2695 1.67e-42 SMART
PostSET 2697 2713 4.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125372
Predicted Effect probably benign
Transcript: ENSMUST00000131002
SMART Domains Protein: ENSMUSP00000118486
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 30 69 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
Pfam:zf-CXXC 255 302 5.2e-15 PFAM
low complexity region 331 353 N/A INTRINSIC
low complexity region 395 407 N/A INTRINSIC
PHD 501 548 1.25e-5 SMART
PHD 549 599 5.4e-10 SMART
PHD 635 692 1.27e-6 SMART
low complexity region 707 719 N/A INTRINSIC
PHD 938 984 3.82e-1 SMART
FYRN 1037 1080 3.25e-19 SMART
low complexity region 1173 1191 N/A INTRINSIC
low complexity region 1204 1234 N/A INTRINSIC
low complexity region 1253 1270 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
low complexity region 1305 1318 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1379 1397 N/A INTRINSIC
low complexity region 1419 1430 N/A INTRINSIC
low complexity region 1507 1527 N/A INTRINSIC
low complexity region 1531 1562 N/A INTRINSIC
low complexity region 1684 1699 N/A INTRINSIC
FYRC 1712 1797 4.83e-36 SMART
SET 1874 1996 1.67e-42 SMART
PostSET 1998 2014 4.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185080
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.4%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains multiple domains including a CXXC zinc finger, three PHD zinc fingers, two FY-rich domains, and a SET (suppressor of variegation, enhancer of zeste, and trithorax) domain. The SET domain is a conserved C-terminal domain that characterizes proteins of the MLL (mixed-lineage leukemia) family. This gene is ubiquitously expressed in adult tissues. It is also amplified in solid tumor cell lines, and may be involved in human cancer. Two alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene, however, the full length nature of the shorter transcript is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic growth retardation, abnormal somite development, neural tube defects, increased apoptosis, and complete embryonic lethality. Homozygotes for a hypomorphic allele show embryonic growth arrest, altered DNA methylation, and reduced female fertility. [provided by MGI curators]
Allele List at MGI

 All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 124 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik TCC TCCCCC 2: 130,770,745 probably benign Het
4930402H24Rik CC CCTGC 2: 130,770,752 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
7530416G11Rik T A 15: 85,494,307 E45V unknown Homo
A530064D06Rik GTAGGAAGCTTAG GTAG 17: 48,163,381 probably benign Homo
Anxa2 C CCCA 9: 69,480,210 probably benign Het
Apol6 GTTT GTTTTTTT 15: 77,051,438 probably null Het
Arrb2 C T 11: 70,438,671 T269M probably damaging Homo
AY761185 CACTGTGGG C 8: 20,943,903 probably null Het
BC051142 GCA GCACCA 17: 34,460,053 probably benign Het
BC051142 AGC AGCCGC 17: 34,460,073 probably benign Het
Bcas3 G A 11: 85,509,497 V431I probably benign Homo
Blm TACC TACCGACC 7: 80,463,770 probably null Het
Btnl10 AGA AGAGGA 11: 58,923,929 probably benign Homo
Btnl4 T A 17: 34,472,636 K293M probably benign Het
Catsper2 TGTC TGTCGTC 2: 121,397,779 probably benign Het
Cd109 ATTTAT ATTTATTTATTTCTTTAT 9: 78,712,529 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Homo
Cd22 C T 7: 30,878,082 R2H possibly damaging Homo
Chd4 C T 6: 125,122,133 P1597L probably benign Homo
Chd4 CCCCTGCCCCTGCCACTGCCCCTGCC CCCCTGCCCCTGCCCCTGCCACTGCCCCTGCC 6: 125,122,139 probably benign Homo
Chga AGC AGCTGC 12: 102,561,402 probably benign Het
Cluh AGCC AGCCTGGGCC 11: 74,669,531 probably benign Het
Cnpy3 ACCC ACCCCCC 17: 46,736,739 probably benign Het
Cntnap1 CCCAGC CCCAGCTCCAGC 11: 101,189,566 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,575 probably benign Het
Cntnap1 CAGCCC CAGCCCGAGCCC 11: 101,189,580 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,581 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Het
Col6a5 A T 9: 105,934,174 N715K unknown Homo
Cttnbp2 ATT ATTTCTGTT 6: 18,367,458 probably benign Het
D230025D16Rik G A 8: 105,241,098 G207E probably benign Homo
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,677 probably benign Het
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,680 probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,683 probably benign Het
Dbr1 GGAGGA GGAGGAAGAGGA 9: 99,583,696 probably benign Het
Dclre1a AGGCTTTG AG 19: 56,544,123 probably benign Het
Dcpp1 A C 17: 23,881,454 K53Q probably benign Het
Dhx8 CGAGAC CGAGACAGAGAC 11: 101,738,188 probably benign Homo
Dnah12 G T 14: 26,849,385 G2817V probably damaging Homo
Dthd1 C CTT 5: 62,843,026 probably null Homo
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Eps8 AC ACTCGC 6: 137,517,069 probably null Het
Ermn TTC TTCATC 2: 58,048,069 probably benign Het
Fam81b TC TCTCC 13: 76,271,323 probably benign Het
Fbrsl1 TG TGCGTGTGCTGGCG 5: 110,378,150 probably benign Het
Fbxo43 GCCTGT GCCTGTTCCTGT 15: 36,152,100 probably benign Het
Fbxo43 CCTGTG CCTGTGTCTGTG 15: 36,152,101 probably benign Het
Fmn1 CTCCTC CTCCTCTTCCTC 2: 113,525,773 probably benign Het
Fmn1 TCCTCC TCCTCCCCCTCC 2: 113,525,774 probably benign Het
Frmpd2 G T 14: 33,511,021 L399F probably damaging Homo
Gabre GCTCCGACTCCGACTCCG GCTCCGACTCCGACTCCGACTCCG X: 72,270,030 probably benign Homo
Gabre ACTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC ACTCCGGCTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC X: 72,270,042 probably benign Homo
Gbp2b A G 3: 142,603,652 I175V probably benign Het
Gm10324 G A 13: 66,122,208 S396N probably benign Het
Gm4340 CAG CAGTAG 10: 104,196,078 probably null Het
Gm4340 AGC AGCCGC 10: 104,196,079 probably benign Het
Gm4340 AG AGCCG 10: 104,196,100 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
Ighv5-9 C T 12: 113,661,877 S82N probably benign Homo
Ipo9 CCATC CCATCATC 1: 135,386,266 probably benign Het
Ipo9 TCC TCCCCC 1: 135,386,281 probably benign Het
Isg20l2 GAAA GAAAAAA 3: 87,931,717 probably benign Homo
Klra9 C G 6: 130,182,403 D216H probably benign Het
Krt10 TCC TCCGCCGCC 11: 99,389,276 probably benign Het
Las1l TCTTCC TCTTCCGCTTCC X: 95,940,619 probably benign Het
Las1l TTCCTCCTCCTC TTCCTC X: 95,940,621 probably benign Het
Las1l TC TCTTCCAC X: 95,940,625 probably benign Het
Lce1m TGCTGCCACC TGCTGCCACCACGGCTGCCACC 3: 93,018,268 probably benign Homo
Lor GCCGCCGCC GC 3: 92,081,894 probably null Het
Lrit3 AC ACATCC 3: 129,803,913 probably null Het
Lrrc63 CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 14: 75,125,182 probably benign Homo
Mapk7 GG GGTGCTAG 11: 61,490,222 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Nacad GGGTCA GGGTCATGGTCA 11: 6,599,753 probably benign Het
Ndufc2 G C 7: 97,400,290 M34I probably benign Het
Nphp3 CACG C 9: 104,025,939 probably benign Het
Nrg3 AG AGCCTTTG 14: 38,397,266 probably benign Het
Pdik1l TTTTTGTTTT TTTTTGTTTTGATTTTGTTTT 4: 134,279,368 probably null Homo
Pdik1l TTTTGTTTT TTTTGTTTTGTGTTTGTTTT 4: 134,279,369 probably null Homo
Plekhs1 AC ACCTCCCCCGAGGC 19: 56,479,863 probably benign Het
Prag1 CCGC CCGCCGC 8: 36,103,883 probably benign Homo
Prtg G A 9: 72,856,865 R540Q probably damaging Het
Raet1d T TCCTCTCTGGTAG 10: 22,370,918 probably null Homo
Rhbdf1 A ATTTT 11: 32,214,391 probably benign Het
Rps19 AAAATT AAAATTGAAATT 7: 24,889,182 probably benign Het
Rtbdn GGCAGC GGCAGCCGCAGC 8: 84,956,171 probably benign Het
Scaf4 TGCGGC TGC 16: 90,229,854 probably benign Homo
Serac1 T A 17: 6,070,808 K70N probably damaging Homo
Setd1a CTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CTGGTGGTGGTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,785,297 probably benign Het
Shf TCT TCTGCT 2: 122,354,177 probably benign Homo
Shroom4 TGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCA X: 6,624,061 probably benign Homo
Six3 CGG CGGAGG 17: 85,621,365 probably benign Het
Snx1 TCT TCTCCT 9: 66,104,926 probably benign Homo
Spag17 AGG AGGGGG 3: 100,056,245 probably benign Het
Spag17 GGA GGATGA 3: 100,056,258 probably benign Het
Speer4a C A 5: 26,036,748 E127* probably null Het
Sry ACTG ACTGCTG Y: 2,662,818 probably benign Het
Supt20 GCAGCA GCAGCATCAGCA 3: 54,727,651 probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,655 probably benign Het
Supt20 A AGCAGCT 3: 54,727,671 probably benign Het
Tcof1 GGGTA G 18: 60,828,650 probably benign Homo
Tert C CAAGGGTGCG 13: 73,648,304 probably benign Het
Tmbim7 C T 5: 3,670,064 R100C possibly damaging Het
Tmed6 C CTAGA 8: 107,061,598 probably null Homo
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Tob1 CA CAGCAA 11: 94,214,477 probably null Het
Trcg1 AGCTCCTGTGTCTGT A 9: 57,242,202 probably null Homo
Trim16 A AAGC 11: 62,820,695 probably benign Homo
Tubgcp4 GTGA G 2: 121,175,463 probably benign Het
Tusc1 ACCGCC ACCGCCCCCGCC 4: 93,335,307 probably benign Het
Ubtf CTCTTC CTCTTCTTC 11: 102,306,943 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Vars GTGG GTGGAGTCCTGGTTGG 17: 35,015,988 probably benign Homo
Vmn2r52 C T 7: 10,159,020 E731K probably damaging Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Homo
Zc3h13 CGGGATGTGCG CGGGATGTGCGGGATGTGCG 14: 75,323,592 probably benign Homo
Zc3h13 TGTGCGAG TGTGCGAGGAGTGCGAG 14: 75,323,597 probably benign Het
Zc3h13 GTGCGAGAT GTGCGAGATTTGCGAGAT 14: 75,323,598 probably benign Het
Zfhx3 CAGCA CAGCAACAGAAGCA 8: 108,956,101 probably benign Het
Zfp282 GGC GGCAGC 6: 47,904,791 probably benign Het
Zfp459 GA GAGTTA 13: 67,408,275 probably null Homo
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,779 probably benign Het
Zfp831 TCC TCCCCC 2: 174,645,468 probably benign Het
Other mutations in Kmt2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Kmt2b APN 7 30586513 unclassified probably benign
IGL00821:Kmt2b APN 7 30570613 missense probably damaging 1.00
IGL00985:Kmt2b APN 7 30579927 missense probably damaging 1.00
IGL01092:Kmt2b APN 7 30580507 missense probably damaging 1.00
IGL01933:Kmt2b APN 7 30569514 critical splice donor site probably null
IGL01949:Kmt2b APN 7 30577161 splice site probably null
IGL02253:Kmt2b APN 7 30581727 missense probably damaging 1.00
IGL02455:Kmt2b APN 7 30578878 critical splice donor site probably null
IGL02493:Kmt2b APN 7 30569511 unclassified probably benign
IGL02504:Kmt2b APN 7 30586543 unclassified probably benign
IGL02532:Kmt2b APN 7 30586889 unclassified probably benign
IGL02698:Kmt2b APN 7 30578693 splice site probably benign
IGL02717:Kmt2b APN 7 30583444 missense probably damaging 1.00
IGL02826:Kmt2b APN 7 30577144 missense probably damaging 1.00
IGL02966:Kmt2b APN 7 30575462 missense probably benign 0.02
IGL03386:Kmt2b APN 7 30573971 missense possibly damaging 0.94
3-1:Kmt2b UTSW 7 30569615 nonsense probably null
FR4304:Kmt2b UTSW 7 30586363 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586363 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586369 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586375 unclassified probably benign
FR4342:Kmt2b UTSW 7 30586375 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586361 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586369 unclassified probably benign
FR4548:Kmt2b UTSW 7 30586380 unclassified probably benign
FR4589:Kmt2b UTSW 7 30586364 nonsense probably null
FR4589:Kmt2b UTSW 7 30586381 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586367 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586370 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586378 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586360 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586362 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586364 nonsense probably null
FR4976:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586373 unclassified probably benign
R0057:Kmt2b UTSW 7 30576792 splice site probably benign
R0131:Kmt2b UTSW 7 30583921 missense probably damaging 0.99
R0241:Kmt2b UTSW 7 30577069 missense probably damaging 1.00
R0241:Kmt2b UTSW 7 30577069 missense probably damaging 1.00
R0377:Kmt2b UTSW 7 30574193 missense probably damaging 1.00
R0396:Kmt2b UTSW 7 30576755 missense probably damaging 1.00
R1241:Kmt2b UTSW 7 30574940 missense probably damaging 0.98
R1252:Kmt2b UTSW 7 30580487 missense probably damaging 0.99
R1418:Kmt2b UTSW 7 30576960 splice site probably benign
R1599:Kmt2b UTSW 7 30570575 missense probably damaging 1.00
R1632:Kmt2b UTSW 7 30583962 missense probably damaging 1.00
R1745:Kmt2b UTSW 7 30585850 missense possibly damaging 0.90
R1867:Kmt2b UTSW 7 30574658 missense possibly damaging 0.71
R1955:Kmt2b UTSW 7 30575351 missense possibly damaging 0.90
R2040:Kmt2b UTSW 7 30569420 missense probably damaging 1.00
R2113:Kmt2b UTSW 7 30583387 missense probably damaging 1.00
R2216:Kmt2b UTSW 7 30574065 missense probably benign 0.25
R2401:Kmt2b UTSW 7 30576708 missense probably damaging 1.00
R2518:Kmt2b UTSW 7 30576068 missense probably benign 0.10
R3436:Kmt2b UTSW 7 30576692 missense probably damaging 1.00
R4248:Kmt2b UTSW 7 30574064 missense probably benign 0.25
R4259:Kmt2b UTSW 7 30581081 missense probably damaging 0.99
R4290:Kmt2b UTSW 7 30581836 critical splice donor site probably null
R4388:Kmt2b UTSW 7 30588590 unclassified probably benign
R4542:Kmt2b UTSW 7 30580259 missense probably damaging 0.99
R4649:Kmt2b UTSW 7 30586358 unclassified probably benign
R4722:Kmt2b UTSW 7 30583202 missense probably damaging 1.00
R4891:Kmt2b UTSW 7 30576761 nonsense probably null
R4916:Kmt2b UTSW 7 30578517 missense probably damaging 0.99
R5104:Kmt2b UTSW 7 30569840 missense probably damaging 1.00
R5254:Kmt2b UTSW 7 30569175 missense probably damaging 1.00
R5262:Kmt2b UTSW 7 30569794 missense probably damaging 1.00
R5307:Kmt2b UTSW 7 30581673 missense possibly damaging 0.91
R5526:Kmt2b UTSW 7 30580444 missense probably damaging 1.00
R5609:Kmt2b UTSW 7 30577145 missense probably damaging 0.99
R6150:Kmt2b UTSW 7 30588477 unclassified probably benign
R6727:Kmt2b UTSW 7 30584559 missense probably damaging 0.98
R6824:Kmt2b UTSW 7 30586276 unclassified probably benign
X0067:Kmt2b UTSW 7 30579573 missense probably damaging 0.99
Z1088:Kmt2b UTSW 7 30585251 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CCCTCTTCCTAGAGCATGTAGC -3'
(R):5'- TGTTTCCAAGGCCAAGAAAGTG -3'

Sequencing Primer
(F):5'- AGGAGACTCTTCCTGCTTCTCTG -3'
(R):5'- TTTCCAAGGCCAAGAAAGTGAAGATG -3'
Posted On2018-04-05