Incidental Mutation 'FR4449:Cpne1'
ID511449
Institutional Source Beutler Lab
Gene Symbol Cpne1
Ensembl Gene ENSMUSG00000074643
Gene Namecopine I
Synonyms1810028N16Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.617) question?
Stock #FR4449 ()
Quality Score126.627
Status Not validated
Chromosome2
Chromosomal Location156071842-156111965 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) CCTACT to CCT at 156073502 bp
ZygosityHomozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038860] [ENSMUST00000079312] [ENSMUST00000109607] [ENSMUST00000109608] [ENSMUST00000132494] [ENSMUST00000136296] [ENSMUST00000142960] [ENSMUST00000147627] [ENSMUST00000153634] [ENSMUST00000184265]
Predicted Effect probably benign
Transcript: ENSMUST00000038860
SMART Domains Protein: ENSMUSP00000036484
Gene: ENSMUSG00000038180

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 19 37 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 166 188 N/A INTRINSIC
low complexity region 214 222 N/A INTRINSIC
Pfam:Sad1_UNC 293 426 1.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079312
SMART Domains Protein: ENSMUSP00000078292
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 468 8.96e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109607
SMART Domains Protein: ENSMUSP00000105236
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109608
SMART Domains Protein: ENSMUSP00000105237
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126513
Predicted Effect probably benign
Transcript: ENSMUST00000127956
SMART Domains Protein: ENSMUSP00000114923
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
low complexity region 10 28 N/A INTRINSIC
low complexity region 73 172 N/A INTRINSIC
RRM 217 287 1.05e-1 SMART
RRM 343 415 2.73e-7 SMART
RRM 457 529 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132494
SMART Domains Protein: ENSMUSP00000139175
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 1.5e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133511
Predicted Effect probably benign
Transcript: ENSMUST00000136296
SMART Domains Protein: ENSMUSP00000122994
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 123 218 7.88e-5 SMART
Pfam:Copine 279 378 2.3e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136765
Predicted Effect probably benign
Transcript: ENSMUST00000140109
SMART Domains Protein: ENSMUSP00000121998
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
Pfam:Copine 1 148 2.1e-50 PFAM
Pfam:vWA-TerF-like 5 111 2.5e-7 PFAM
low complexity region 167 185 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142960
SMART Domains Protein: ENSMUSP00000121299
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 2.4e-11 SMART
C2 123 206 3e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142975
Predicted Effect probably benign
Transcript: ENSMUST00000147627
SMART Domains Protein: ENSMUSP00000116982
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
Pfam:Copine 303 350 1.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149139
Predicted Effect probably benign
Transcript: ENSMUST00000153634
SMART Domains Protein: ENSMUSP00000115167
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 123 218 7.88e-5 SMART
Pfam:Copine 279 325 4.1e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183353
Predicted Effect probably benign
Transcript: ENSMUST00000183733
Predicted Effect probably benign
Transcript: ENSMUST00000184265
SMART Domains Protein: ENSMUSP00000138888
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184933
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.3%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that contains two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. Its activity is also upregulated in mouse embryos. This gene and the gene for RNA binding motif protein 12 overlap at map location 2 H2. Two alternatively spliced variants that encode the same isoform have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,625,035 E594V probably benign Homo
2010300C02Rik C A 1: 37,625,036 E594* probably null Homo
4932415D10Rik TTCAGT TT 10: 82,285,469 probably null Homo
Akap9 GGTATTGCATTTCTTATCT G 5: 3,981,214 probably benign Homo
Amfr C G 8: 94,005,159 G30R probably damaging Homo
Anxa7 C T 14: 20,469,411 G113E probably damaging Homo
Apc AATAAAGC AATAAAGCCGATAAAGC 18: 34,282,000 probably benign Het
Apc AGC AGCCAATAACGC 18: 34,282,005 probably benign Het
Apol6 TTT TTTGATT 15: 77,051,443 probably null Homo
Arid1b CGG CGGTGG 17: 4,995,589 probably benign Het
B430218F22Rik CGGCG CGGCGATGGCG 13: 118,386,851 probably benign Homo
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTTCTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,908 probably benign Het
Brd2 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAAAAA 17: 34,116,336 probably benign Het
Btnl10 AAG AAGGAG 11: 58,923,928 probably benign Homo
Cacna1a ACC ACCCCC 8: 84,638,714 probably benign Het
Cacna1a ACC ACCCCC 8: 84,638,720 probably benign Het
Cacna1a ACC ACCGCC 8: 84,638,723 probably benign Het
Calhm1 TGGC TGGCTGTGGCTGCGGC 19: 47,141,274 probably benign Het
Ccdc15 C CTTTAT 9: 37,315,158 probably null Het
Ccdc85c CCG CCGACG 12: 108,274,616 probably benign Het
Ccnk TTCCCAC T 12: 108,202,507 probably benign Het
Cdhr2 AGTC AGTCGTC 13: 54,725,924 probably benign Homo
Cdk15 A ATCTAAAAGG 1: 59,257,823 probably benign Homo
Cdx1 GCTG GCTGCTCCTG 18: 61,019,881 probably benign Het
Cfap46 T C 7: 139,638,795 probably benign Homo
Cgref1 TTC TTCGTC 5: 30,933,776 probably benign Het
Cgref1 CTT CTTATT 5: 30,933,778 probably null Homo
Cluh G GACTGAA 11: 74,669,532 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,569 probably benign Het
Cntnap1 AGCC AGCCCCCGCC 11: 101,189,593 probably benign Het
Cttnbp2 CTGCTG CTGCTGTTGCTG 6: 18,367,462 probably benign Het
Cul9 TCC TCCGCC 17: 46,500,856 probably benign Het
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,674 probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,686 probably benign Het
Dbr1 GGAGGA GGAGGAAGAGGA 9: 99,583,696 probably benign Het
Dhx8 AGACCG AGACCGTGACCG 11: 101,738,184 probably benign Homo
Dhx8 AGACCGGGACCGGGACCGGGACCGGGAC AGACCGGGACCGGGAC 11: 101,738,190 probably benign Het
Dhx8 CG CGAGACAG 11: 101,738,194 probably benign Homo
Dhx8 CG CGAGACAG 11: 101,738,206 probably benign Het
Dhx8 G GAGACCC 11: 101,738,207 probably benign Het
Dspp CGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAG CGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAG 5: 104,178,388 probably benign Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Homo
Erich3 GA GAGAA 3: 154,763,513 probably benign Homo
Ermn CTT CTTGTT 2: 58,048,074 probably benign Het
Fgd6 GGAT G 10: 94,044,320 probably benign Homo
G530012D18Rik GAGAGAGAGAGAGAGAGACAGAGA GAGAGA 1: 85,577,180 probably benign Homo
Gar1 GCCGCCTCCGCC GCCGCC 3: 129,830,704 probably benign Homo
Gatad2b AGAC A 3: 90,341,917 probably benign Het
Gigyf2 C T 1: 87,428,585 probably benign Het
Gm16519 A AGAT 17: 70,929,338 probably benign Homo
Gm4340 AGC AGCGGC 10: 104,196,082 probably benign Het
Gm4340 AGC AGCGGC 10: 104,196,085 probably benign Het
Gm4340 GCA GCATCA 10: 104,196,086 probably benign Het
Gpatch11 AGGAAG AGGAAGCGGAAG 17: 78,842,168 probably benign Het
Gpatch11 GAAGAG GAAGAGCAAGAG 17: 78,842,176 probably benign Het
Gpatch11 GG GGCAGACG 17: 78,842,181 probably benign Het
Hoxa10 T A 6: 52,234,186 Q250L possibly damaging Homo
Igkv12-89 GCA GCAGCAGCAACA 6: 68,835,280 probably benign Homo
Igsf10 G A 3: 59,319,110 R2381C probably damaging Homo
Il17rd GGC GGCAGC 14: 27,082,678 probably benign Het
Ints5 G A 19: 8,897,230 R851Q probably benign Het
Isg20l2 AGA AGAGGA 3: 87,931,713 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Homo
Kifc5b A C 17: 26,924,217 E321A probably benign Het
Klra2 TCCACAG TCCACAGAAACCCACAG 6: 131,221,846 probably null Homo
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,586,361 probably benign Het
Kmt2b TCCTCC TCCTCCACCTCC 7: 30,586,366 probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,369 probably benign Het
Krt10 ACC ACCACCTCC 11: 99,389,267 probably benign Het
Las1l GA GAGAA X: 95,940,832 probably benign Het
Lce1m AC ACTGCTGCTGCCGC 3: 93,018,152 probably benign Het
Leo1 GTACCATGCA G 9: 75,450,573 probably benign Het
Lkaaear1 CA CATCTCCAGCTCTA 2: 181,697,571 probably benign Het
Maml2 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA 9: 13,621,456 probably benign Homo
Med12l CAG CAGTAG 3: 59,275,963 probably null Het
Mgat4e GTCGTAGTCATCGT GTCGT 1: 134,540,997 probably benign Homo
Mn1 GCA GCAACA 5: 111,419,710 probably benign Het
Morn4 AGGCAGTGAG AGGCAGTGAGTCTGGCAGTGAG 19: 42,076,109 probably benign Het
Nat8f2 T A 6: 85,867,686 L231F possibly damaging Homo
Noc2l C CTGA 4: 156,240,101 probably benign Het
Nrg3 T TAGACAC 14: 38,397,271 probably benign Het
Olfr890 A G 9: 38,143,188 I13V probably benign Homo
Piezo1 G A 8: 122,495,569 R503W probably damaging Homo
Pih1d2 CTCTTGCGAGGATC CTC 9: 50,621,627 probably null Homo
Pik3ap1 G GGAA 19: 41,281,946 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Homo
Ptms TTC TTCGTC 6: 124,914,459 probably benign Het
Ptpn23 G T 9: 110,387,633 P1052T probably benign Homo
Qrich2 AACT A 11: 116,456,199 probably benign Homo
Raet1d A ATATCCTCTCTGG 10: 22,370,915 probably benign Het
Rbm33 AGCAGCAGCAGCACCAGCCGCAGCAGCAGCA AGCAGCAGCAGCA 5: 28,394,168 probably benign Homo
Rrbp1 TGCTTCTCAAAGGTGGCTGCCTTGGCTTC TGCTTC 2: 143,967,456 probably null Het
Sbp CAACAAAGATGCTGA CAACAAAGATGCTGAGAACAAAGATGCTGA 17: 23,945,364 probably benign Het
Setd1a G A 7: 127,785,326 probably benign Het
Sfswap CCCACTCAG CCCACTCAGTCCACTCAG 5: 129,569,748 probably benign Het
Sfswap CCACTCAGC CCACTCAGCTCACTCAGC 5: 129,569,749 probably benign Het
Sh3pxd2b T TGTCTGC 11: 32,423,065 probably benign Homo
Six3 CGG CGGGGG 17: 85,621,362 probably benign Het
Slc12a1 C CTTTGGCCACAACACG 2: 125,154,216 probably benign Homo
Slc26a8 CTCTCTG C 17: 28,638,316 probably benign Het
Srebf2 G T 15: 82,185,335 A693S probably damaging Homo
Sry ACTG ACTGCTG Y: 2,662,818 probably benign Het
Sry TGCTG TGCTGCTG Y: 2,662,832 probably benign Homo
Ston1 G A 17: 88,635,525 V120M probably benign Homo
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,649 probably benign Het
Tbl3 TG TGTGG 17: 24,702,544 probably benign Homo
Tctn3 AG AGAAGCCG 19: 40,607,202 probably benign Het
Tesk1 CCC CCCACC 4: 43,447,002 probably benign Homo
Tmc2 T G 2: 130,240,196 V433G probably damaging Het
Tmprss13 G A 9: 45,328,558 A55T unknown Het
Tnfaip8 ACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,046,839 probably null Homo
Tob1 CAG CAGAAG 11: 94,214,468 probably benign Het
Tob1 AGC AGCCGC 11: 94,214,475 probably benign Het
Tpsab1 TTGCACCTCCT TT 17: 25,343,782 probably benign Homo
Triobp GTC GTCTTC 15: 78,993,389 probably benign Het
Ubtf CCT CCTACT 11: 102,306,948 probably null Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Homo
Xpnpep3 G C 15: 81,427,422 D110H possibly damaging Het
Zc3h13 CGAGATGTG CGAGATGTGTGAGATGTG 14: 75,323,601 probably null Homo
Zfhx3 GCAACAGCA GCAACAGCAACAACAGCA 8: 108,956,094 probably benign Homo
Zfp26 C A 9: 20,438,546 A241S probably benign Homo
Zfp335 CTC CTCATC 2: 164,907,477 probably benign Het
Zfp335 CTCT CTCTTCT 2: 164,907,483 probably benign Het
Zfp598 ACCACC ACCACCTCCACC 17: 24,680,776 probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,785 probably benign Het
Zfp831 TCC TCCACC 2: 174,645,471 probably benign Het
Zfp831 CTC CTCGTC 2: 174,645,482 probably benign Het
Zfp978 G T 4: 147,390,944 S316I probably benign Het
Other mutations in Cpne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02118:Cpne1 APN 2 156077643 missense possibly damaging 0.90
IGL02291:Cpne1 APN 2 156078420 missense probably damaging 1.00
IGL02719:Cpne1 APN 2 156078217 missense probably damaging 1.00
IGL03011:Cpne1 APN 2 156077997 missense probably damaging 0.99
IGL03347:Cpne1 APN 2 156079176 missense probably damaging 1.00
johannesburg UTSW 2 156077641 missense probably damaging 1.00
FR4304:Cpne1 UTSW 2 156072025 frame shift probably null
FR4976:Cpne1 UTSW 2 156072025 frame shift probably null
R0496:Cpne1 UTSW 2 156079419 missense probably damaging 0.99
R0735:Cpne1 UTSW 2 156078750 critical splice donor site probably null
R0792:Cpne1 UTSW 2 156077419 missense probably benign 0.00
R1874:Cpne1 UTSW 2 156078382 missense probably damaging 0.99
R2015:Cpne1 UTSW 2 156078388 missense probably damaging 1.00
R2518:Cpne1 UTSW 2 156073971 missense probably damaging 0.99
R3000:Cpne1 UTSW 2 156073422 makesense probably null
R3875:Cpne1 UTSW 2 156076282 missense probably damaging 1.00
R5021:Cpne1 UTSW 2 156098273 intron probably benign
R5385:Cpne1 UTSW 2 156074364 missense probably damaging 0.99
R5654:Cpne1 UTSW 2 156077641 missense probably damaging 1.00
R5959:Cpne1 UTSW 2 156078223 missense probably benign 0.00
R6775:Cpne1 UTSW 2 156078420 missense probably damaging 1.00
R7049:Cpne1 UTSW 2 156078807 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCAAAGCAAGTGTGGCTCTC -3'
(R):5'- ACCAGGGAAACTTACAGGCC -3'

Sequencing Primer
(F):5'- CAAAGCAAGTGTGGCTCTCTCTAG -3'
(R):5'- GATCTCGCCTCTCTTCTGGC -3'
Posted On2018-04-05