Incidental Mutation 'FR4449:Zfp335'
Institutional Source Beutler Lab
Gene Symbol Zfp335
Ensembl Gene ENSMUSG00000039834
Gene Namezinc finger protein 335
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #FR4449 ()
Quality Score197.468
Status Not validated
Chromosomal Location164891882-164911757 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) CTC to CTCATC at 164907477 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000139247] [ENSMUST00000183830]
Predicted Effect probably benign
Transcript: ENSMUST00000041361
SMART Domains Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834

low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
ZnF_C2H2 591 613 2.53e-2 SMART
ZnF_C2H2 622 644 6.78e-3 SMART
ZnF_C2H2 650 673 8.22e-2 SMART
ZnF_C2H2 679 702 3.29e-1 SMART
low complexity region 711 726 N/A INTRINSIC
internal_repeat_3 770 937 7.16e-5 PROSPERO
low complexity region 1005 1015 N/A INTRINSIC
ZnF_C2H2 1019 1041 2.95e-3 SMART
ZnF_C2H2 1047 1069 5.5e-3 SMART
ZnF_C2H2 1075 1097 1.58e-3 SMART
ZnF_C2H2 1103 1126 3.34e-2 SMART
low complexity region 1288 1305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129364
Predicted Effect probably benign
Transcript: ENSMUST00000139247
SMART Domains Protein: ENSMUSP00000138664
Gene: ENSMUSG00000039834

low complexity region 5 12 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183830
SMART Domains Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834

low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.3%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. Mice homozygous for a conditional allele activated in the brain exhibit loss of cortical neurons and decreased brain size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,625,035 E594V probably benign Homo
2010300C02Rik C A 1: 37,625,036 E594* probably null Homo
4932415D10Rik TTCAGT TT 10: 82,285,469 probably null Homo
Akap9 GGTATTGCATTTCTTATCT G 5: 3,981,214 probably benign Homo
Amfr C G 8: 94,005,159 G30R probably damaging Homo
Anxa7 C T 14: 20,469,411 G113E probably damaging Homo
Apc AATAAAGC AATAAAGCCGATAAAGC 18: 34,282,000 probably benign Het
Apc AGC AGCCAATAACGC 18: 34,282,005 probably benign Het
Apol6 TTT TTTGATT 15: 77,051,443 probably null Homo
Arid1b CGG CGGTGG 17: 4,995,589 probably benign Het
B430218F22Rik CGGCG CGGCGATGGCG 13: 118,386,851 probably benign Homo
Btnl10 AAG AAGGAG 11: 58,923,928 probably benign Homo
Cacna1a ACC ACCCCC 8: 84,638,714 probably benign Het
Cacna1a ACC ACCCCC 8: 84,638,720 probably benign Het
Cacna1a ACC ACCGCC 8: 84,638,723 probably benign Het
Calhm1 TGGC TGGCTGTGGCTGCGGC 19: 47,141,274 probably benign Het
Ccdc15 C CTTTAT 9: 37,315,158 probably null Het
Ccdc85c CCG CCGACG 12: 108,274,616 probably benign Het
Ccnk TTCCCAC T 12: 108,202,507 probably benign Het
Cdhr2 AGTC AGTCGTC 13: 54,725,924 probably benign Homo
Cdk15 A ATCTAAAAGG 1: 59,257,823 probably benign Homo
Cdx1 GCTG GCTGCTCCTG 18: 61,019,881 probably benign Het
Cfap46 T C 7: 139,638,795 probably benign Homo
Cgref1 TTC TTCGTC 5: 30,933,776 probably benign Het
Cgref1 CTT CTTATT 5: 30,933,778 probably null Homo
Cluh G GACTGAA 11: 74,669,532 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,569 probably benign Het
Cntnap1 AGCC AGCCCCCGCC 11: 101,189,593 probably benign Het
Cpne1 CCTACT CCT 2: 156,073,502 probably benign Homo
Cttnbp2 CTGCTG CTGCTGTTGCTG 6: 18,367,462 probably benign Het
Cul9 TCC TCCGCC 17: 46,500,856 probably benign Het
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,674 probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,686 probably benign Het
Dbr1 GGAGGA GGAGGAAGAGGA 9: 99,583,696 probably benign Het
Dhx8 AGACCG AGACCGTGACCG 11: 101,738,184 probably benign Homo
Dhx8 CG CGAGACAG 11: 101,738,194 probably benign Homo
Dhx8 CG CGAGACAG 11: 101,738,206 probably benign Het
Dhx8 G GAGACCC 11: 101,738,207 probably benign Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Homo
Erich3 GA GAGAA 3: 154,763,513 probably benign Homo
Ermn CTT CTTGTT 2: 58,048,074 probably benign Het
Fgd6 GGAT G 10: 94,044,320 probably benign Homo
G530012D18Rik GAGAGAGAGAGAGAGAGACAGAGA GAGAGA 1: 85,577,180 probably benign Homo
Gar1 GCCGCCTCCGCC GCCGCC 3: 129,830,704 probably benign Homo
Gatad2b AGAC A 3: 90,341,917 probably benign Het
Gigyf2 C T 1: 87,428,585 probably benign Het
Gm16519 A AGAT 17: 70,929,338 probably benign Homo
Gm4340 AGC AGCGGC 10: 104,196,082 probably benign Het
Gm4340 AGC AGCGGC 10: 104,196,085 probably benign Het
Gm4340 GCA GCATCA 10: 104,196,086 probably benign Het
Gpatch11 AGGAAG AGGAAGCGGAAG 17: 78,842,168 probably benign Het
Gpatch11 GAAGAG GAAGAGCAAGAG 17: 78,842,176 probably benign Het
Gpatch11 GG GGCAGACG 17: 78,842,181 probably benign Het
Hoxa10 T A 6: 52,234,186 Q250L possibly damaging Homo
Igkv12-89 GCA GCAGCAGCAACA 6: 68,835,280 probably benign Homo
Igsf10 G A 3: 59,319,110 R2381C probably damaging Homo
Il17rd GGC GGCAGC 14: 27,082,678 probably benign Het
Ints5 G A 19: 8,897,230 R851Q probably benign Het
Isg20l2 AGA AGAGGA 3: 87,931,713 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Homo
Kifc5b A C 17: 26,924,217 E321A probably benign Het
Klra2 TCCACAG TCCACAGAAACCCACAG 6: 131,221,846 probably null Homo
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,586,361 probably benign Het
Kmt2b TCCTCC TCCTCCACCTCC 7: 30,586,366 probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,369 probably benign Het
Krt10 ACC ACCACCTCC 11: 99,389,267 probably benign Het
Las1l GA GAGAA X: 95,940,832 probably benign Het
Lce1m AC ACTGCTGCTGCCGC 3: 93,018,152 probably benign Het
Leo1 GTACCATGCA G 9: 75,450,573 probably benign Het
Lkaaear1 CA CATCTCCAGCTCTA 2: 181,697,571 probably benign Het
Med12l CAG CAGTAG 3: 59,275,963 probably null Het
Mgat4e GTCGTAGTCATCGT GTCGT 1: 134,540,997 probably benign Homo
Mn1 GCA GCAACA 5: 111,419,710 probably benign Het
Morn4 AGGCAGTGAG AGGCAGTGAGTCTGGCAGTGAG 19: 42,076,109 probably benign Het
Nat8f2 T A 6: 85,867,686 L231F possibly damaging Homo
Noc2l C CTGA 4: 156,240,101 probably benign Het
Nrg3 T TAGACAC 14: 38,397,271 probably benign Het
Olfr890 A G 9: 38,143,188 I13V probably benign Homo
Piezo1 G A 8: 122,495,569 R503W probably damaging Homo
Pih1d2 CTCTTGCGAGGATC CTC 9: 50,621,627 probably null Homo
Pik3ap1 G GGAA 19: 41,281,946 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Homo
Ptms TTC TTCGTC 6: 124,914,459 probably benign Het
Ptpn23 G T 9: 110,387,633 P1052T probably benign Homo
Qrich2 AACT A 11: 116,456,199 probably benign Homo
Raet1d A ATATCCTCTCTGG 10: 22,370,915 probably benign Het
Rrbp1 TGCTTCTCAAAGGTGGCTGCCTTGGCTTC TGCTTC 2: 143,967,456 probably null Het
Setd1a G A 7: 127,785,326 probably benign Het
Sfswap CCCACTCAG CCCACTCAGTCCACTCAG 5: 129,569,748 probably benign Het
Sfswap CCACTCAGC CCACTCAGCTCACTCAGC 5: 129,569,749 probably benign Het
Sh3pxd2b T TGTCTGC 11: 32,423,065 probably benign Homo
Six3 CGG CGGGGG 17: 85,621,362 probably benign Het
Slc12a1 C CTTTGGCCACAACACG 2: 125,154,216 probably benign Homo
Slc26a8 CTCTCTG C 17: 28,638,316 probably benign Het
Srebf2 G T 15: 82,185,335 A693S probably damaging Homo
Sry ACTG ACTGCTG Y: 2,662,818 probably benign Het
Sry TGCTG TGCTGCTG Y: 2,662,832 probably benign Homo
Ston1 G A 17: 88,635,525 V120M probably benign Homo
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,649 probably benign Het
Tbl3 TG TGTGG 17: 24,702,544 probably benign Homo
Tctn3 AG AGAAGCCG 19: 40,607,202 probably benign Het
Tesk1 CCC CCCACC 4: 43,447,002 probably benign Homo
Tmc2 T G 2: 130,240,196 V433G probably damaging Het
Tmprss13 G A 9: 45,328,558 A55T unknown Het
Tob1 CAG CAGAAG 11: 94,214,468 probably benign Het
Tob1 AGC AGCCGC 11: 94,214,475 probably benign Het
Tpsab1 TTGCACCTCCT TT 17: 25,343,782 probably benign Homo
Triobp GTC GTCTTC 15: 78,993,389 probably benign Het
Ubtf CCT CCTACT 11: 102,306,948 probably null Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Homo
Xpnpep3 G C 15: 81,427,422 D110H possibly damaging Het
Zc3h13 CGAGATGTG CGAGATGTGTGAGATGTG 14: 75,323,601 probably null Homo
Zfhx3 GCAACAGCA GCAACAGCAACAACAGCA 8: 108,956,094 probably benign Homo
Zfp26 C A 9: 20,438,546 A241S probably benign Homo
Zfp598 ACCACC ACCACCTCCACC 17: 24,680,776 probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,785 probably benign Het
Zfp831 TCC TCCACC 2: 174,645,471 probably benign Het
Zfp831 CTC CTCGTC 2: 174,645,482 probably benign Het
Zfp978 G T 4: 147,390,944 S316I probably benign Het
Other mutations in Zfp335
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Zfp335 APN 2 164892382 missense probably damaging 1.00
IGL00921:Zfp335 APN 2 164894776 missense possibly damaging 0.51
IGL00980:Zfp335 APN 2 164902674 nonsense probably null
IGL01145:Zfp335 APN 2 164907502 missense probably benign 0.03
IGL01568:Zfp335 APN 2 164894788 missense possibly damaging 0.70
IGL01612:Zfp335 APN 2 164910620 critical splice donor site probably null
IGL02138:Zfp335 APN 2 164893804 missense probably damaging 1.00
IGL02675:Zfp335 APN 2 164910689 missense probably benign
IGL03206:Zfp335 APN 2 164892681 splice site probably benign
IGL03269:Zfp335 APN 2 164900354 missense probably damaging 1.00
IGL03306:Zfp335 APN 2 164895984 splice site probably benign
FR4342:Zfp335 UTSW 2 164907465 small insertion probably benign
FR4342:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907483 small insertion probably benign
FR4548:Zfp335 UTSW 2 164907472 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907475 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907484 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907478 small insertion probably benign
PIT4403001:Zfp335 UTSW 2 164893716 missense possibly damaging 0.56
R0005:Zfp335 UTSW 2 164909302 missense possibly damaging 0.91
R0101:Zfp335 UTSW 2 164899990 missense probably damaging 1.00
R0196:Zfp335 UTSW 2 164896145 missense possibly damaging 0.88
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0533:Zfp335 UTSW 2 164907922 nonsense probably null
R0865:Zfp335 UTSW 2 164899495 splice site probably null
R1023:Zfp335 UTSW 2 164892585 missense possibly damaging 0.88
R1029:Zfp335 UTSW 2 164892678 splice site probably benign
R1052:Zfp335 UTSW 2 164907468 small deletion probably benign
R1106:Zfp335 UTSW 2 164907551 small deletion probably benign
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1274:Zfp335 UTSW 2 164907468 small deletion probably benign
R1386:Zfp335 UTSW 2 164898241 missense probably benign 0.00
R1433:Zfp335 UTSW 2 164899456 missense probably damaging 0.99
R1813:Zfp335 UTSW 2 164892605 missense probably damaging 0.99
R1959:Zfp335 UTSW 2 164894802 missense probably damaging 1.00
R2372:Zfp335 UTSW 2 164895039 missense probably damaging 1.00
R3847:Zfp335 UTSW 2 164900106 splice site probably null
R3937:Zfp335 UTSW 2 164910700 missense probably damaging 1.00
R3946:Zfp335 UTSW 2 164892189 missense probably damaging 1.00
R3979:Zfp335 UTSW 2 164910638 missense probably benign 0.00
R4019:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4020:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4668:Zfp335 UTSW 2 164900286 missense probably damaging 1.00
R5000:Zfp335 UTSW 2 164894668 missense probably benign
R5038:Zfp335 UTSW 2 164910644 nonsense probably null
R5245:Zfp335 UTSW 2 164894758 missense probably benign
R5411:Zfp335 UTSW 2 164902245 missense probably damaging 0.99
R5422:Zfp335 UTSW 2 164907730 missense probably damaging 1.00
R5968:Zfp335 UTSW 2 164892394 missense probably damaging 0.99
R6056:Zfp335 UTSW 2 164895098 splice site probably null
R6551:Zfp335 UTSW 2 164909365 missense probably benign
R6927:Zfp335 UTSW 2 164893720 missense probably damaging 1.00
R6943:Zfp335 UTSW 2 164894875 missense possibly damaging 0.50
R6995:Zfp335 UTSW 2 164893290 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2018-04-05