Incidental Mutation 'FR4449:Tesk1'
ID511463
Institutional Source Beutler Lab
Gene Symbol Tesk1
Ensembl Gene ENSMUSG00000028458
Gene Nametestis specific protein kinase 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #FR4449 ()
Quality Score214.458
Status Not validated
Chromosome4
Chromosomal Location43441939-43448064 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) CCC to CCCACC at 43447002 bp
ZygosityHomozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030179] [ENSMUST00000060864] [ENSMUST00000098104] [ENSMUST00000098105] [ENSMUST00000107925] [ENSMUST00000107926] [ENSMUST00000138981]
Predicted Effect probably benign
Transcript: ENSMUST00000030179
SMART Domains Protein: ENSMUSP00000030179
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
coiled coil region 137 223 N/A INTRINSIC
CLECT 232 348 2.28e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060864
SMART Domains Protein: ENSMUSP00000050087
Gene: ENSMUSG00000028458

DomainStartEndE-ValueType
low complexity region 2 33 N/A INTRINSIC
Pfam:Pkinase 52 306 5.4e-46 PFAM
Pfam:Pkinase_Tyr 52 306 3.1e-47 PFAM
low complexity region 316 330 N/A INTRINSIC
low complexity region 345 370 N/A INTRINSIC
low complexity region 403 424 N/A INTRINSIC
low complexity region 472 490 N/A INTRINSIC
low complexity region 513 525 N/A INTRINSIC
low complexity region 549 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098104
SMART Domains Protein: ENSMUSP00000095708
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
coiled coil region 83 169 N/A INTRINSIC
CLECT 178 287 2.48e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098105
SMART Domains Protein: ENSMUSP00000095709
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
coiled coil region 113 199 N/A INTRINSIC
CLECT 208 324 2.28e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107925
SMART Domains Protein: ENSMUSP00000103558
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
coiled coil region 137 223 N/A INTRINSIC
CLECT 232 334 2.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107926
SMART Domains Protein: ENSMUSP00000103559
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
coiled coil region 137 223 N/A INTRINSIC
CLECT 232 341 2.48e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137178
Predicted Effect probably benign
Transcript: ENSMUST00000138981
SMART Domains Protein: ENSMUSP00000121067
Gene: ENSMUSG00000028458

DomainStartEndE-ValueType
low complexity region 2 33 N/A INTRINSIC
Pfam:Pkinase 52 174 7.6e-29 PFAM
Pfam:Pkinase_Tyr 52 175 1.5e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156810
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.3%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a serine/threonine protein kinase that contains an N-terminal protein kinase domain and a C-terminal proline-rich domain. Its protein kinase domain is most closely related to those of the LIM motif-containing protein kinases (LIMKs). The encoded protein can phosphorylate myelin basic protein and histone in vitro. The testicular germ cell-specific expression and developmental pattern of expression of the mouse gene suggests that this gene plays an important role at and after the meiotic phase of spermatogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,625,035 E594V probably benign Homo
2010300C02Rik C A 1: 37,625,036 E594* probably null Homo
4932415D10Rik TTCAGT TT 10: 82,285,469 probably null Homo
Akap9 GGTATTGCATTTCTTATCT G 5: 3,981,214 probably benign Homo
Amfr C G 8: 94,005,159 G30R probably damaging Homo
Anxa7 C T 14: 20,469,411 G113E probably damaging Homo
Apc AATAAAGC AATAAAGCCGATAAAGC 18: 34,282,000 probably benign Het
Apc AGC AGCCAATAACGC 18: 34,282,005 probably benign Het
Apol6 TTT TTTGATT 15: 77,051,443 probably null Homo
Arid1b CGG CGGTGG 17: 4,995,589 probably benign Het
B430218F22Rik CGGCG CGGCGATGGCG 13: 118,386,851 probably benign Homo
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTTCTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,908 probably benign Het
Brd2 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAAAAA 17: 34,116,336 probably benign Het
Btnl10 AAG AAGGAG 11: 58,923,928 probably benign Homo
Cacna1a ACC ACCCCC 8: 84,638,714 probably benign Het
Cacna1a ACC ACCCCC 8: 84,638,720 probably benign Het
Cacna1a ACC ACCGCC 8: 84,638,723 probably benign Het
Calhm1 TGGC TGGCTGTGGCTGCGGC 19: 47,141,274 probably benign Het
Ccdc15 C CTTTAT 9: 37,315,158 probably null Het
Ccdc85c CCG CCGACG 12: 108,274,616 probably benign Het
Ccnk TTCCCAC T 12: 108,202,507 probably benign Het
Cdhr2 AGTC AGTCGTC 13: 54,725,924 probably benign Homo
Cdk15 A ATCTAAAAGG 1: 59,257,823 probably benign Homo
Cdx1 GCTG GCTGCTCCTG 18: 61,019,881 probably benign Het
Cfap46 T C 7: 139,638,795 probably benign Homo
Cgref1 TTC TTCGTC 5: 30,933,776 probably benign Het
Cgref1 CTT CTTATT 5: 30,933,778 probably null Homo
Cluh G GACTGAA 11: 74,669,532 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,569 probably benign Het
Cntnap1 AGCC AGCCCCCGCC 11: 101,189,593 probably benign Het
Cpne1 CCTACT CCT 2: 156,073,502 probably benign Homo
Cttnbp2 CTGCTG CTGCTGTTGCTG 6: 18,367,462 probably benign Het
Cul9 TCC TCCGCC 17: 46,500,856 probably benign Het
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,674 probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,686 probably benign Het
Dbr1 GGAGGA GGAGGAAGAGGA 9: 99,583,696 probably benign Het
Dhx8 AGACCG AGACCGTGACCG 11: 101,738,184 probably benign Homo
Dhx8 AGACCGGGACCGGGACCGGGACCGGGAC AGACCGGGACCGGGAC 11: 101,738,190 probably benign Het
Dhx8 CG CGAGACAG 11: 101,738,194 probably benign Homo
Dhx8 CG CGAGACAG 11: 101,738,206 probably benign Het
Dhx8 G GAGACCC 11: 101,738,207 probably benign Het
Dspp CGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAG CGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAG 5: 104,178,388 probably benign Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Homo
Erich3 GA GAGAA 3: 154,763,513 probably benign Homo
Ermn CTT CTTGTT 2: 58,048,074 probably benign Het
Fgd6 GGAT G 10: 94,044,320 probably benign Homo
G530012D18Rik GAGAGAGAGAGAGAGAGACAGAGA GAGAGA 1: 85,577,180 probably benign Homo
Gar1 GCCGCCTCCGCC GCCGCC 3: 129,830,704 probably benign Homo
Gatad2b AGAC A 3: 90,341,917 probably benign Het
Gigyf2 C T 1: 87,428,585 probably benign Het
Gm16519 A AGAT 17: 70,929,338 probably benign Homo
Gm4340 AGC AGCGGC 10: 104,196,082 probably benign Het
Gm4340 AGC AGCGGC 10: 104,196,085 probably benign Het
Gm4340 GCA GCATCA 10: 104,196,086 probably benign Het
Gpatch11 AGGAAG AGGAAGCGGAAG 17: 78,842,168 probably benign Het
Gpatch11 GAAGAG GAAGAGCAAGAG 17: 78,842,176 probably benign Het
Gpatch11 GG GGCAGACG 17: 78,842,181 probably benign Het
Hoxa10 T A 6: 52,234,186 Q250L possibly damaging Homo
Igkv12-89 GCA GCAGCAGCAACA 6: 68,835,280 probably benign Homo
Igsf10 G A 3: 59,319,110 R2381C probably damaging Homo
Il17rd GGC GGCAGC 14: 27,082,678 probably benign Het
Ints5 G A 19: 8,897,230 R851Q probably benign Het
Isg20l2 AGA AGAGGA 3: 87,931,713 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Homo
Kifc5b A C 17: 26,924,217 E321A probably benign Het
Klra2 TCCACAG TCCACAGAAACCCACAG 6: 131,221,846 probably null Homo
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,586,361 probably benign Het
Kmt2b TCCTCC TCCTCCACCTCC 7: 30,586,366 probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,369 probably benign Het
Krt10 ACC ACCACCTCC 11: 99,389,267 probably benign Het
Las1l GA GAGAA X: 95,940,832 probably benign Het
Lce1m AC ACTGCTGCTGCCGC 3: 93,018,152 probably benign Het
Leo1 GTACCATGCA G 9: 75,450,573 probably benign Het
Lkaaear1 CA CATCTCCAGCTCTA 2: 181,697,571 probably benign Het
Maml2 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA 9: 13,621,456 probably benign Homo
Med12l CAG CAGTAG 3: 59,275,963 probably null Het
Mgat4e GTCGTAGTCATCGT GTCGT 1: 134,540,997 probably benign Homo
Mn1 GCA GCAACA 5: 111,419,710 probably benign Het
Morn4 AGGCAGTGAG AGGCAGTGAGTCTGGCAGTGAG 19: 42,076,109 probably benign Het
Nat8f2 T A 6: 85,867,686 L231F possibly damaging Homo
Noc2l C CTGA 4: 156,240,101 probably benign Het
Nrg3 T TAGACAC 14: 38,397,271 probably benign Het
Olfr890 A G 9: 38,143,188 I13V probably benign Homo
Piezo1 G A 8: 122,495,569 R503W probably damaging Homo
Pih1d2 CTCTTGCGAGGATC CTC 9: 50,621,627 probably null Homo
Pik3ap1 G GGAA 19: 41,281,946 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Homo
Ptms TTC TTCGTC 6: 124,914,459 probably benign Het
Ptpn23 G T 9: 110,387,633 P1052T probably benign Homo
Qrich2 AACT A 11: 116,456,199 probably benign Homo
Raet1d A ATATCCTCTCTGG 10: 22,370,915 probably benign Het
Rbm33 AGCAGCAGCAGCACCAGCCGCAGCAGCAGCA AGCAGCAGCAGCA 5: 28,394,168 probably benign Homo
Rrbp1 TGCTTCTCAAAGGTGGCTGCCTTGGCTTC TGCTTC 2: 143,967,456 probably null Het
Sbp CAACAAAGATGCTGA CAACAAAGATGCTGAGAACAAAGATGCTGA 17: 23,945,364 probably benign Het
Setd1a G A 7: 127,785,326 probably benign Het
Sfswap CCCACTCAG CCCACTCAGTCCACTCAG 5: 129,569,748 probably benign Het
Sfswap CCACTCAGC CCACTCAGCTCACTCAGC 5: 129,569,749 probably benign Het
Sh3pxd2b T TGTCTGC 11: 32,423,065 probably benign Homo
Six3 CGG CGGGGG 17: 85,621,362 probably benign Het
Slc12a1 C CTTTGGCCACAACACG 2: 125,154,216 probably benign Homo
Slc26a8 CTCTCTG C 17: 28,638,316 probably benign Het
Srebf2 G T 15: 82,185,335 A693S probably damaging Homo
Sry ACTG ACTGCTG Y: 2,662,818 probably benign Het
Sry TGCTG TGCTGCTG Y: 2,662,832 probably benign Homo
Ston1 G A 17: 88,635,525 V120M probably benign Homo
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,649 probably benign Het
Tbl3 TG TGTGG 17: 24,702,544 probably benign Homo
Tctn3 AG AGAAGCCG 19: 40,607,202 probably benign Het
Tmc2 T G 2: 130,240,196 V433G probably damaging Het
Tmprss13 G A 9: 45,328,558 A55T unknown Het
Tnfaip8 ACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,046,839 probably null Homo
Tob1 CAG CAGAAG 11: 94,214,468 probably benign Het
Tob1 AGC AGCCGC 11: 94,214,475 probably benign Het
Tpsab1 TTGCACCTCCT TT 17: 25,343,782 probably benign Homo
Triobp GTC GTCTTC 15: 78,993,389 probably benign Het
Ubtf CCT CCTACT 11: 102,306,948 probably null Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Homo
Xpnpep3 G C 15: 81,427,422 D110H possibly damaging Het
Zc3h13 CGAGATGTG CGAGATGTGTGAGATGTG 14: 75,323,601 probably null Homo
Zfhx3 GCAACAGCA GCAACAGCAACAACAGCA 8: 108,956,094 probably benign Homo
Zfp26 C A 9: 20,438,546 A241S probably benign Homo
Zfp335 CTC CTCATC 2: 164,907,477 probably benign Het
Zfp335 CTCT CTCTTCT 2: 164,907,483 probably benign Het
Zfp598 ACCACC ACCACCTCCACC 17: 24,680,776 probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,785 probably benign Het
Zfp831 TCC TCCACC 2: 174,645,471 probably benign Het
Zfp831 CTC CTCGTC 2: 174,645,482 probably benign Het
Zfp978 G T 4: 147,390,944 S316I probably benign Het
Other mutations in Tesk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01755:Tesk1 APN 4 43445820 critical splice donor site probably null
IGL02969:Tesk1 APN 4 43447027 missense possibly damaging 0.49
IGL02969:Tesk1 APN 4 43447026 nonsense probably null
FR4737:Tesk1 UTSW 4 43447004 frame shift probably null
R0009:Tesk1 UTSW 4 43445368 missense probably damaging 0.99
R0396:Tesk1 UTSW 4 43446000 missense probably damaging 0.99
R0765:Tesk1 UTSW 4 43446706 missense possibly damaging 0.81
R1850:Tesk1 UTSW 4 43443576 missense probably damaging 1.00
R1868:Tesk1 UTSW 4 43447201 missense probably damaging 0.99
R1903:Tesk1 UTSW 4 43446998 missense probably benign 0.00
R3961:Tesk1 UTSW 4 43445133 splice site probably null
R3973:Tesk1 UTSW 4 43445786 missense possibly damaging 0.50
R3975:Tesk1 UTSW 4 43445786 missense possibly damaging 0.50
R3976:Tesk1 UTSW 4 43445786 missense possibly damaging 0.50
R4074:Tesk1 UTSW 4 43443606 missense possibly damaging 0.88
R4908:Tesk1 UTSW 4 43445555 nonsense probably null
R5002:Tesk1 UTSW 4 43444573 missense probably damaging 1.00
R5237:Tesk1 UTSW 4 43447100 missense probably damaging 0.98
R6755:Tesk1 UTSW 4 43445991 missense probably benign 0.03
R6886:Tesk1 UTSW 4 43443592 missense possibly damaging 0.72
R6991:Tesk1 UTSW 4 43447006 missense probably benign
R6992:Tesk1 UTSW 4 43447006 missense probably benign
R6993:Tesk1 UTSW 4 43447006 missense probably benign
X0064:Tesk1 UTSW 4 43443534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCAAGCTGCTGGACAC -3'
(R):5'- TGGGGAATTCACCACCACAG -3'

Sequencing Primer
(F):5'- AAGCTGCTGGACACACCCTG -3'
(R):5'- CACCACAGCAGGGGGATTATTG -3'
Posted On2018-04-05