Incidental Mutation 'FR4449:Setd1a'
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene NameSET domain containing 1A
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #FR4449 ()
Quality Score86.0076
Status Not validated
Chromosomal Location127776670-127800122 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 127785326 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000126761] [ENSMUST00000144406] [ENSMUST00000154987]
Predicted Effect unknown
Transcript: ENSMUST00000047075
AA Change: G450S
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308
AA Change: G450S

RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000047157
AA Change: G450S
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308
AA Change: G450S

RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126761
SMART Domains Protein: ENSMUSP00000120666
Gene: ENSMUSG00000042308

RRM 95 168 7.6e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141439
Predicted Effect probably benign
Transcript: ENSMUST00000144406
SMART Domains Protein: ENSMUSP00000115248
Gene: ENSMUSG00000042308

RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154987
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.3%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,625,035 E594V probably benign Homo
2010300C02Rik C A 1: 37,625,036 E594* probably null Homo
4932415D10Rik TTCAGT TT 10: 82,285,469 probably null Homo
Akap9 GGTATTGCATTTCTTATCT G 5: 3,981,214 probably benign Homo
Amfr C G 8: 94,005,159 G30R probably damaging Homo
Anxa7 C T 14: 20,469,411 G113E probably damaging Homo
Apc AATAAAGC AATAAAGCCGATAAAGC 18: 34,282,000 probably benign Het
Apc AGC AGCCAATAACGC 18: 34,282,005 probably benign Het
Apol6 TTT TTTGATT 15: 77,051,443 probably null Homo
Arid1b CGG CGGTGG 17: 4,995,589 probably benign Het
B430218F22Rik CGGCG CGGCGATGGCG 13: 118,386,851 probably benign Homo
Btnl10 AAG AAGGAG 11: 58,923,928 probably benign Homo
Cacna1a ACC ACCCCC 8: 84,638,714 probably benign Het
Cacna1a ACC ACCCCC 8: 84,638,720 probably benign Het
Cacna1a ACC ACCGCC 8: 84,638,723 probably benign Het
Calhm1 TGGC TGGCTGTGGCTGCGGC 19: 47,141,274 probably benign Het
Ccdc15 C CTTTAT 9: 37,315,158 probably null Het
Ccdc85c CCG CCGACG 12: 108,274,616 probably benign Het
Ccnk TTCCCAC T 12: 108,202,507 probably benign Het
Cdhr2 AGTC AGTCGTC 13: 54,725,924 probably benign Homo
Cdk15 A ATCTAAAAGG 1: 59,257,823 probably benign Homo
Cdx1 GCTG GCTGCTCCTG 18: 61,019,881 probably benign Het
Cfap46 T C 7: 139,638,795 probably benign Homo
Cgref1 TTC TTCGTC 5: 30,933,776 probably benign Het
Cgref1 CTT CTTATT 5: 30,933,778 probably null Homo
Cluh G GACTGAA 11: 74,669,532 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,569 probably benign Het
Cntnap1 AGCC AGCCCCCGCC 11: 101,189,593 probably benign Het
Cpne1 CCTACT CCT 2: 156,073,502 probably benign Homo
Cttnbp2 CTGCTG CTGCTGTTGCTG 6: 18,367,462 probably benign Het
Cul9 TCC TCCGCC 17: 46,500,856 probably benign Het
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,674 probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,686 probably benign Het
Dbr1 GGAGGA GGAGGAAGAGGA 9: 99,583,696 probably benign Het
Dhx8 AGACCG AGACCGTGACCG 11: 101,738,184 probably benign Homo
Dhx8 CG CGAGACAG 11: 101,738,194 probably benign Homo
Dhx8 CG CGAGACAG 11: 101,738,206 probably benign Het
Dhx8 G GAGACCC 11: 101,738,207 probably benign Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Homo
Erich3 GA GAGAA 3: 154,763,513 probably benign Homo
Ermn CTT CTTGTT 2: 58,048,074 probably benign Het
Fgd6 GGAT G 10: 94,044,320 probably benign Homo
G530012D18Rik GAGAGAGAGAGAGAGAGACAGAGA GAGAGA 1: 85,577,180 probably benign Homo
Gar1 GCCGCCTCCGCC GCCGCC 3: 129,830,704 probably benign Homo
Gatad2b AGAC A 3: 90,341,917 probably benign Het
Gigyf2 C T 1: 87,428,585 probably benign Het
Gm16519 A AGAT 17: 70,929,338 probably benign Homo
Gm4340 AGC AGCGGC 10: 104,196,082 probably benign Het
Gm4340 AGC AGCGGC 10: 104,196,085 probably benign Het
Gm4340 GCA GCATCA 10: 104,196,086 probably benign Het
Gpatch11 AGGAAG AGGAAGCGGAAG 17: 78,842,168 probably benign Het
Gpatch11 GAAGAG GAAGAGCAAGAG 17: 78,842,176 probably benign Het
Gpatch11 GG GGCAGACG 17: 78,842,181 probably benign Het
Hoxa10 T A 6: 52,234,186 Q250L possibly damaging Homo
Igkv12-89 GCA GCAGCAGCAACA 6: 68,835,280 probably benign Homo
Igsf10 G A 3: 59,319,110 R2381C probably damaging Homo
Il17rd GGC GGCAGC 14: 27,082,678 probably benign Het
Ints5 G A 19: 8,897,230 R851Q probably benign Het
Isg20l2 AGA AGAGGA 3: 87,931,713 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Homo
Kifc5b A C 17: 26,924,217 E321A probably benign Het
Klra2 TCCACAG TCCACAGAAACCCACAG 6: 131,221,846 probably null Homo
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,586,361 probably benign Het
Kmt2b TCCTCC TCCTCCACCTCC 7: 30,586,366 probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,369 probably benign Het
Krt10 ACC ACCACCTCC 11: 99,389,267 probably benign Het
Las1l GA GAGAA X: 95,940,832 probably benign Het
Lce1m AC ACTGCTGCTGCCGC 3: 93,018,152 probably benign Het
Leo1 GTACCATGCA G 9: 75,450,573 probably benign Het
Lkaaear1 CA CATCTCCAGCTCTA 2: 181,697,571 probably benign Het
Med12l CAG CAGTAG 3: 59,275,963 probably null Het
Mgat4e GTCGTAGTCATCGT GTCGT 1: 134,540,997 probably benign Homo
Mn1 GCA GCAACA 5: 111,419,710 probably benign Het
Morn4 AGGCAGTGAG AGGCAGTGAGTCTGGCAGTGAG 19: 42,076,109 probably benign Het
Nat8f2 T A 6: 85,867,686 L231F possibly damaging Homo
Noc2l C CTGA 4: 156,240,101 probably benign Het
Nrg3 T TAGACAC 14: 38,397,271 probably benign Het
Olfr890 A G 9: 38,143,188 I13V probably benign Homo
Piezo1 G A 8: 122,495,569 R503W probably damaging Homo
Pih1d2 CTCTTGCGAGGATC CTC 9: 50,621,627 probably null Homo
Pik3ap1 G GGAA 19: 41,281,946 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Homo
Ptms TTC TTCGTC 6: 124,914,459 probably benign Het
Ptpn23 G T 9: 110,387,633 P1052T probably benign Homo
Qrich2 AACT A 11: 116,456,199 probably benign Homo
Raet1d A ATATCCTCTCTGG 10: 22,370,915 probably benign Het
Rrbp1 TGCTTCTCAAAGGTGGCTGCCTTGGCTTC TGCTTC 2: 143,967,456 probably null Het
Sfswap CCCACTCAG CCCACTCAGTCCACTCAG 5: 129,569,748 probably benign Het
Sfswap CCACTCAGC CCACTCAGCTCACTCAGC 5: 129,569,749 probably benign Het
Sh3pxd2b T TGTCTGC 11: 32,423,065 probably benign Homo
Six3 CGG CGGGGG 17: 85,621,362 probably benign Het
Slc12a1 C CTTTGGCCACAACACG 2: 125,154,216 probably benign Homo
Slc26a8 CTCTCTG C 17: 28,638,316 probably benign Het
Srebf2 G T 15: 82,185,335 A693S probably damaging Homo
Sry ACTG ACTGCTG Y: 2,662,818 probably benign Het
Sry TGCTG TGCTGCTG Y: 2,662,832 probably benign Homo
Ston1 G A 17: 88,635,525 V120M probably benign Homo
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,649 probably benign Het
Tbl3 TG TGTGG 17: 24,702,544 probably benign Homo
Tctn3 AG AGAAGCCG 19: 40,607,202 probably benign Het
Tesk1 CCC CCCACC 4: 43,447,002 probably benign Homo
Tmc2 T G 2: 130,240,196 V433G probably damaging Het
Tmprss13 G A 9: 45,328,558 A55T unknown Het
Tob1 CAG CAGAAG 11: 94,214,468 probably benign Het
Tob1 AGC AGCCGC 11: 94,214,475 probably benign Het
Tpsab1 TTGCACCTCCT TT 17: 25,343,782 probably benign Homo
Triobp GTC GTCTTC 15: 78,993,389 probably benign Het
Ubtf CCT CCTACT 11: 102,306,948 probably null Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Homo
Xpnpep3 G C 15: 81,427,422 D110H possibly damaging Het
Zc3h13 CGAGATGTG CGAGATGTGTGAGATGTG 14: 75,323,601 probably null Homo
Zfhx3 GCAACAGCA GCAACAGCAACAACAGCA 8: 108,956,094 probably benign Homo
Zfp26 C A 9: 20,438,546 A241S probably benign Homo
Zfp335 CTC CTCATC 2: 164,907,477 probably benign Het
Zfp335 CTCT CTCTTCT 2: 164,907,483 probably benign Het
Zfp598 ACCACC ACCACCTCCACC 17: 24,680,776 probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,785 probably benign Het
Zfp831 TCC TCCACC 2: 174,645,471 probably benign Het
Zfp831 CTC CTCGTC 2: 174,645,482 probably benign Het
Zfp978 G T 4: 147,390,944 S316I probably benign Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127797698 unclassified probably benign
IGL02657:Setd1a APN 7 127795825 unclassified probably benign
IGL02792:Setd1a APN 7 127791350 missense unknown
IGL02876:Setd1a APN 7 127778501 splice site probably benign
IGL02967:Setd1a APN 7 127785177 unclassified probably benign
IGL03090:Setd1a APN 7 127786500 missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127785546 missense possibly damaging 0.86
FR4548:Setd1a UTSW 7 127785307 unclassified probably benign
FR4548:Setd1a UTSW 7 127785313 unclassified probably benign
FR4589:Setd1a UTSW 7 127785297 unclassified probably benign
FR4737:Setd1a UTSW 7 127785312 unclassified probably benign
FR4976:Setd1a UTSW 7 127785307 unclassified probably benign
FR4976:Setd1a UTSW 7 127785316 unclassified probably benign
R0367:Setd1a UTSW 7 127788186 splice site probably benign
R0411:Setd1a UTSW 7 127796051 unclassified probably benign
R0416:Setd1a UTSW 7 127785297 unclassified probably benign
R0470:Setd1a UTSW 7 127785057 unclassified probably benign
R0645:Setd1a UTSW 7 127787210 missense probably damaging 0.96
R0667:Setd1a UTSW 7 127786593 missense probably damaging 0.99
R1251:Setd1a UTSW 7 127797424 unclassified probably benign
R1465:Setd1a UTSW 7 127788340 unclassified probably benign
R1465:Setd1a UTSW 7 127788340 unclassified probably benign
R1660:Setd1a UTSW 7 127796669 unclassified probably benign
R1730:Setd1a UTSW 7 127785124 nonsense probably null
R1760:Setd1a UTSW 7 127785890 missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127785124 nonsense probably null
R2149:Setd1a UTSW 7 127786518 missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127785489 missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127799155 unclassified probably benign
R2679:Setd1a UTSW 7 127795724 unclassified probably benign
R3428:Setd1a UTSW 7 127785321 unclassified probably benign
R4108:Setd1a UTSW 7 127799202 unclassified probably benign
R4227:Setd1a UTSW 7 127796647 unclassified probably benign
R4438:Setd1a UTSW 7 127785731 missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127797330 unclassified probably benign
R4869:Setd1a UTSW 7 127797604 unclassified probably benign
R4892:Setd1a UTSW 7 127778524 missense probably damaging 0.99
R5152:Setd1a UTSW 7 127784025 missense probably benign
R5502:Setd1a UTSW 7 127797248 critical splice donor site probably null
R5527:Setd1a UTSW 7 127785629 missense probably damaging 0.99
R6189:Setd1a UTSW 7 127778283 splice site probably null
R6250:Setd1a UTSW 7 127791299 missense unknown
R7131:Setd1a UTSW 7 127796418 small deletion probably benign
Predicted Primers
Posted On2018-04-05