Incidental Mutation 'FR4449:Ubtf'
ID511523
Institutional Source Beutler Lab
Gene Symbol Ubtf
Ensembl Gene ENSMUSG00000020923
Gene Nameupstream binding transcription factor, RNA polymerase I
SynonymsA930005G04Rik, UBF1, Tcfubf, UBF
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.978) question?
Stock #FR4449 ()
Quality Score211.468
Status Not validated
Chromosome11
Chromosomal Location102304560-102319742 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) CCT to CCTACT at 102306948 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006754] [ENSMUST00000079589] [ENSMUST00000107115] [ENSMUST00000107117] [ENSMUST00000107119] [ENSMUST00000107123] [ENSMUST00000146896] [ENSMUST00000173870] [ENSMUST00000174302] [ENSMUST00000178839]
Predicted Effect probably benign
Transcript: ENSMUST00000006754
SMART Domains Protein: ENSMUSP00000006754
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 6e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 640 661 N/A INTRINSIC
low complexity region 677 705 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000079589
SMART Domains Protein: ENSMUSP00000078539
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107115
SMART Domains Protein: ENSMUSP00000102732
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107117
SMART Domains Protein: ENSMUSP00000102734
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107119
SMART Domains Protein: ENSMUSP00000102736
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107123
SMART Domains Protein: ENSMUSP00000102740
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146896
SMART Domains Protein: ENSMUSP00000134665
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 1e-34 BLAST
HMG 83 151 2.09e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173870
SMART Domains Protein: ENSMUSP00000133611
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174302
SMART Domains Protein: ENSMUSP00000133844
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174726
Predicted Effect probably null
Transcript: ENSMUST00000178839
SMART Domains Protein: ENSMUSP00000136310
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.3%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HMG-box DNA-binding protein family. The encoded protein plays a critical role in ribosomal RNA transcription as a key component of the pre-initiation complex, mediating the recruitment of RNA polymerase I to rDNA promoter regions. The encoded protein may also play important roles in chromatin remodeling and pre-rRNA processing, and its activity is regulated by both phosphorylation and acetylation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Pseudogenes of this gene are located on the short arm of chromosomes 3, 11 and X and the long arm of chromosome 11. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before implantation with embryonic growth arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,625,035 E594V probably benign Homo
2010300C02Rik C A 1: 37,625,036 E594* probably null Homo
4932415D10Rik TTCAGT TT 10: 82,285,469 probably null Homo
Akap9 GGTATTGCATTTCTTATCT G 5: 3,981,214 probably benign Homo
Amfr C G 8: 94,005,159 G30R probably damaging Homo
Anxa7 C T 14: 20,469,411 G113E probably damaging Homo
Apc AATAAAGC AATAAAGCCGATAAAGC 18: 34,282,000 probably benign Het
Apc AGC AGCCAATAACGC 18: 34,282,005 probably benign Het
Apol6 TTT TTTGATT 15: 77,051,443 probably null Homo
Arid1b CGG CGGTGG 17: 4,995,589 probably benign Het
B430218F22Rik CGGCG CGGCGATGGCG 13: 118,386,851 probably benign Homo
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTTCTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,908 probably benign Het
Brd2 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAAAAA 17: 34,116,336 probably benign Het
Btnl10 AAG AAGGAG 11: 58,923,928 probably benign Homo
Cacna1a ACC ACCCCC 8: 84,638,714 probably benign Het
Cacna1a ACC ACCCCC 8: 84,638,720 probably benign Het
Cacna1a ACC ACCGCC 8: 84,638,723 probably benign Het
Calhm1 TGGC TGGCTGTGGCTGCGGC 19: 47,141,274 probably benign Het
Ccdc15 C CTTTAT 9: 37,315,158 probably null Het
Ccdc85c CCG CCGACG 12: 108,274,616 probably benign Het
Ccnk TTCCCAC T 12: 108,202,507 probably benign Het
Cdhr2 AGTC AGTCGTC 13: 54,725,924 probably benign Homo
Cdk15 A ATCTAAAAGG 1: 59,257,823 probably benign Homo
Cdx1 GCTG GCTGCTCCTG 18: 61,019,881 probably benign Het
Cfap46 T C 7: 139,638,795 probably benign Homo
Cgref1 TTC TTCGTC 5: 30,933,776 probably benign Het
Cgref1 CTT CTTATT 5: 30,933,778 probably null Homo
Cluh G GACTGAA 11: 74,669,532 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,569 probably benign Het
Cntnap1 AGCC AGCCCCCGCC 11: 101,189,593 probably benign Het
Cpne1 CCTACT CCT 2: 156,073,502 probably benign Homo
Cttnbp2 CTGCTG CTGCTGTTGCTG 6: 18,367,462 probably benign Het
Cul9 TCC TCCGCC 17: 46,500,856 probably benign Het
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,674 probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,686 probably benign Het
Dbr1 GGAGGA GGAGGAAGAGGA 9: 99,583,696 probably benign Het
Dhx8 AGACCG AGACCGTGACCG 11: 101,738,184 probably benign Homo
Dhx8 AGACCGGGACCGGGACCGGGACCGGGAC AGACCGGGACCGGGAC 11: 101,738,190 probably benign Het
Dhx8 CG CGAGACAG 11: 101,738,194 probably benign Homo
Dhx8 CG CGAGACAG 11: 101,738,206 probably benign Het
Dhx8 G GAGACCC 11: 101,738,207 probably benign Het
Dspp CGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAG CGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAG 5: 104,178,388 probably benign Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Homo
Erich3 GA GAGAA 3: 154,763,513 probably benign Homo
Ermn CTT CTTGTT 2: 58,048,074 probably benign Het
Fgd6 GGAT G 10: 94,044,320 probably benign Homo
G530012D18Rik GAGAGAGAGAGAGAGAGACAGAGA GAGAGA 1: 85,577,180 probably benign Homo
Gar1 GCCGCCTCCGCC GCCGCC 3: 129,830,704 probably benign Homo
Gatad2b AGAC A 3: 90,341,917 probably benign Het
Gigyf2 C T 1: 87,428,585 probably benign Het
Gm16519 A AGAT 17: 70,929,338 probably benign Homo
Gm4340 AGC AGCGGC 10: 104,196,082 probably benign Het
Gm4340 AGC AGCGGC 10: 104,196,085 probably benign Het
Gm4340 GCA GCATCA 10: 104,196,086 probably benign Het
Gpatch11 AGGAAG AGGAAGCGGAAG 17: 78,842,168 probably benign Het
Gpatch11 GAAGAG GAAGAGCAAGAG 17: 78,842,176 probably benign Het
Gpatch11 GG GGCAGACG 17: 78,842,181 probably benign Het
Hoxa10 T A 6: 52,234,186 Q250L possibly damaging Homo
Igkv12-89 GCA GCAGCAGCAACA 6: 68,835,280 probably benign Homo
Igsf10 G A 3: 59,319,110 R2381C probably damaging Homo
Il17rd GGC GGCAGC 14: 27,082,678 probably benign Het
Ints5 G A 19: 8,897,230 R851Q probably benign Het
Isg20l2 AGA AGAGGA 3: 87,931,713 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Homo
Kifc5b A C 17: 26,924,217 E321A probably benign Het
Klra2 TCCACAG TCCACAGAAACCCACAG 6: 131,221,846 probably null Homo
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,586,361 probably benign Het
Kmt2b TCCTCC TCCTCCACCTCC 7: 30,586,366 probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,369 probably benign Het
Krt10 ACC ACCACCTCC 11: 99,389,267 probably benign Het
Las1l GA GAGAA X: 95,940,832 probably benign Het
Lce1m AC ACTGCTGCTGCCGC 3: 93,018,152 probably benign Het
Leo1 GTACCATGCA G 9: 75,450,573 probably benign Het
Lkaaear1 CA CATCTCCAGCTCTA 2: 181,697,571 probably benign Het
Maml2 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA 9: 13,621,456 probably benign Homo
Med12l CAG CAGTAG 3: 59,275,963 probably null Het
Mgat4e GTCGTAGTCATCGT GTCGT 1: 134,540,997 probably benign Homo
Mn1 GCA GCAACA 5: 111,419,710 probably benign Het
Morn4 AGGCAGTGAG AGGCAGTGAGTCTGGCAGTGAG 19: 42,076,109 probably benign Het
Nat8f2 T A 6: 85,867,686 L231F possibly damaging Homo
Noc2l C CTGA 4: 156,240,101 probably benign Het
Nrg3 T TAGACAC 14: 38,397,271 probably benign Het
Olfr890 A G 9: 38,143,188 I13V probably benign Homo
Piezo1 G A 8: 122,495,569 R503W probably damaging Homo
Pih1d2 CTCTTGCGAGGATC CTC 9: 50,621,627 probably null Homo
Pik3ap1 G GGAA 19: 41,281,946 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Homo
Ptms TTC TTCGTC 6: 124,914,459 probably benign Het
Ptpn23 G T 9: 110,387,633 P1052T probably benign Homo
Qrich2 AACT A 11: 116,456,199 probably benign Homo
Raet1d A ATATCCTCTCTGG 10: 22,370,915 probably benign Het
Rbm33 AGCAGCAGCAGCACCAGCCGCAGCAGCAGCA AGCAGCAGCAGCA 5: 28,394,168 probably benign Homo
Rrbp1 TGCTTCTCAAAGGTGGCTGCCTTGGCTTC TGCTTC 2: 143,967,456 probably null Het
Sbp CAACAAAGATGCTGA CAACAAAGATGCTGAGAACAAAGATGCTGA 17: 23,945,364 probably benign Het
Setd1a G A 7: 127,785,326 probably benign Het
Sfswap CCCACTCAG CCCACTCAGTCCACTCAG 5: 129,569,748 probably benign Het
Sfswap CCACTCAGC CCACTCAGCTCACTCAGC 5: 129,569,749 probably benign Het
Sh3pxd2b T TGTCTGC 11: 32,423,065 probably benign Homo
Six3 CGG CGGGGG 17: 85,621,362 probably benign Het
Slc12a1 C CTTTGGCCACAACACG 2: 125,154,216 probably benign Homo
Slc26a8 CTCTCTG C 17: 28,638,316 probably benign Het
Srebf2 G T 15: 82,185,335 A693S probably damaging Homo
Sry ACTG ACTGCTG Y: 2,662,818 probably benign Het
Sry TGCTG TGCTGCTG Y: 2,662,832 probably benign Homo
Ston1 G A 17: 88,635,525 V120M probably benign Homo
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,649 probably benign Het
Tbl3 TG TGTGG 17: 24,702,544 probably benign Homo
Tctn3 AG AGAAGCCG 19: 40,607,202 probably benign Het
Tesk1 CCC CCCACC 4: 43,447,002 probably benign Homo
Tmc2 T G 2: 130,240,196 V433G probably damaging Het
Tmprss13 G A 9: 45,328,558 A55T unknown Het
Tnfaip8 ACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,046,839 probably null Homo
Tob1 CAG CAGAAG 11: 94,214,468 probably benign Het
Tob1 AGC AGCCGC 11: 94,214,475 probably benign Het
Tpsab1 TTGCACCTCCT TT 17: 25,343,782 probably benign Homo
Triobp GTC GTCTTC 15: 78,993,389 probably benign Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Homo
Xpnpep3 G C 15: 81,427,422 D110H possibly damaging Het
Zc3h13 CGAGATGTG CGAGATGTGTGAGATGTG 14: 75,323,601 probably null Homo
Zfhx3 GCAACAGCA GCAACAGCAACAACAGCA 8: 108,956,094 probably benign Homo
Zfp26 C A 9: 20,438,546 A241S probably benign Homo
Zfp335 CTC CTCATC 2: 164,907,477 probably benign Het
Zfp335 CTCT CTCTTCT 2: 164,907,483 probably benign Het
Zfp598 ACCACC ACCACCTCCACC 17: 24,680,776 probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,785 probably benign Het
Zfp831 TCC TCCACC 2: 174,645,471 probably benign Het
Zfp831 CTC CTCGTC 2: 174,645,482 probably benign Het
Zfp978 G T 4: 147,390,944 S316I probably benign Het
Other mutations in Ubtf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Ubtf APN 11 102308884 splice site probably benign
IGL02168:Ubtf APN 11 102314168 missense probably damaging 0.99
IGL02218:Ubtf APN 11 102306700 nonsense probably null
FR4304:Ubtf UTSW 11 102306956 small insertion probably benign
FR4304:Ubtf UTSW 11 102306958 small insertion probably benign
FR4340:Ubtf UTSW 11 102306950 small insertion probably benign
FR4342:Ubtf UTSW 11 102306956 small insertion probably benign
FR4342:Ubtf UTSW 11 102306959 small insertion probably benign
FR4548:Ubtf UTSW 11 102306958 small insertion probably benign
FR4589:Ubtf UTSW 11 102306943 small insertion probably benign
FR4589:Ubtf UTSW 11 102306945 small insertion probably benign
FR4737:Ubtf UTSW 11 102306948 nonsense probably null
FR4737:Ubtf UTSW 11 102306950 small insertion probably benign
FR4976:Ubtf UTSW 11 102306959 small insertion probably benign
PIT4504001:Ubtf UTSW 11 102306682 missense unknown
R0919:Ubtf UTSW 11 102309777 splice site probably benign
R1023:Ubtf UTSW 11 102311450 missense possibly damaging 0.93
R1641:Ubtf UTSW 11 102310931 missense probably damaging 1.00
R1678:Ubtf UTSW 11 102308978 missense probably benign 0.01
R1780:Ubtf UTSW 11 102314918 missense probably damaging 1.00
R2406:Ubtf UTSW 11 102308702 nonsense probably null
R4574:Ubtf UTSW 11 102306765 unclassified probably benign
R4986:Ubtf UTSW 11 102314174 missense probably benign 0.03
R5057:Ubtf UTSW 11 102307087 missense probably damaging 0.96
R5217:Ubtf UTSW 11 102308302 missense probably null 0.91
R5221:Ubtf UTSW 11 102307990 nonsense probably null
R5532:Ubtf UTSW 11 102308959 missense probably benign 0.00
R5634:Ubtf UTSW 11 102310324 missense probably damaging 1.00
R6185:Ubtf UTSW 11 102314023 missense probably damaging 1.00
R7028:Ubtf UTSW 11 102314980 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGGAGAATAAAGACCCCACCG -3'
(R):5'- CCCATCCTTTCTGTCAGAAACG -3'

Sequencing Primer
(F):5'- ACCGTCACCGTGTGTGTG -3'
(R):5'- CCTTTCTGTCAGAAACGTAAGAAC -3'
Posted On2018-04-05