Incidental Mutation 'FR4737:Zfp462'
ID511615
Institutional Source Beutler Lab
Gene Symbol Zfp462
Ensembl Gene ENSMUSG00000060206
Gene Namezinc finger protein 462
SynonymsZfpip, 9430078C22Rik, Gt4-2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #FR4737 ()
Quality Score217.468
Status Not validated
Chromosome4
Chromosomal Location54945048-55083563 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) ACC to ACCTCAGCCACAGTCGCC at 55009760 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030131] [ENSMUST00000079605] [ENSMUST00000098070] [ENSMUST00000133895]
Predicted Effect probably benign
Transcript: ENSMUST00000030131
SMART Domains Protein: ENSMUSP00000030131
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 892 914 3.11e-2 SMART
ZnF_C2H2 926 948 4.11e-2 SMART
ZnF_C2H2 955 978 4.98e-1 SMART
ZnF_C2H2 984 1007 5.5e-3 SMART
ZnF_C2H2 1092 1115 7.05e-1 SMART
ZnF_C2H2 1121 1144 5.48e0 SMART
ZnF_C2H2 1155 1177 6.13e-1 SMART
ZnF_C2H2 1201 1223 1.26e-2 SMART
ZnF_C2H2 1229 1252 2.02e-1 SMART
low complexity region 1273 1296 N/A INTRINSIC
ZnF_C2H2 1315 1337 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079605
SMART Domains Protein: ENSMUSP00000078555
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 893 915 3.11e-2 SMART
ZnF_C2H2 927 949 4.11e-2 SMART
ZnF_C2H2 956 979 4.98e-1 SMART
ZnF_C2H2 985 1008 5.5e-3 SMART
ZnF_C2H2 1093 1116 7.05e-1 SMART
ZnF_C2H2 1122 1145 5.48e0 SMART
ZnF_C2H2 1156 1178 6.13e-1 SMART
ZnF_C2H2 1202 1224 1.26e-2 SMART
ZnF_C2H2 1230 1253 2.02e-1 SMART
low complexity region 1274 1297 N/A INTRINSIC
ZnF_C2H2 1316 1338 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098070
SMART Domains Protein: ENSMUSP00000095677
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 4 27 5.81e-2 SMART
low complexity region 81 94 N/A INTRINSIC
ZnF_C2H2 108 131 1.79e-2 SMART
ZnF_C2H2 162 185 4.65e-1 SMART
low complexity region 194 215 N/A INTRINSIC
ZnF_C2H2 243 266 4.98e-1 SMART
low complexity region 332 343 N/A INTRINSIC
ZnF_C2H2 440 463 1.01e-1 SMART
ZnF_C2H2 471 493 2.86e-1 SMART
low complexity region 503 515 N/A INTRINSIC
low complexity region 536 592 N/A INTRINSIC
ZnF_C2H2 593 616 2.53e-2 SMART
low complexity region 707 736 N/A INTRINSIC
ZnF_C2H2 835 858 5.62e0 SMART
ZnF_C2H2 878 900 2.14e0 SMART
ZnF_C2H2 917 940 6.67e-2 SMART
ZnF_C2H2 1023 1046 5.72e-1 SMART
low complexity region 1092 1100 N/A INTRINSIC
ZnF_C2H2 1107 1130 4.23e0 SMART
ZnF_C2H2 1183 1206 4.81e0 SMART
ZnF_C2H2 1254 1277 6.67e-2 SMART
ZnF_C2H2 1301 1324 3.47e0 SMART
ZnF_C2H2 1358 1381 7.29e0 SMART
ZnF_C2H2 1459 1482 2.17e-1 SMART
ZnF_C2H2 1504 1527 6.57e0 SMART
ZnF_C2H2 1566 1589 5.34e-1 SMART
low complexity region 1598 1611 N/A INTRINSIC
ZnF_C2H2 1649 1672 8.22e-2 SMART
ZnF_C2H2 1686 1709 5.34e0 SMART
ZnF_C2H2 1756 1779 6.4e0 SMART
low complexity region 1803 1824 N/A INTRINSIC
ZnF_C2H2 1835 1859 3.05e1 SMART
ZnF_C2H2 1881 1903 1.08e-1 SMART
low complexity region 1905 1919 N/A INTRINSIC
ZnF_C2H2 1957 1979 1.51e0 SMART
ZnF_C2H2 2014 2036 4.11e-2 SMART
ZnF_C2H2 2043 2066 4.98e-1 SMART
ZnF_C2H2 2072 2095 5.5e-3 SMART
ZnF_C2H2 2180 2203 7.05e-1 SMART
ZnF_C2H2 2209 2232 5.48e0 SMART
ZnF_C2H2 2243 2265 6.13e-1 SMART
ZnF_C2H2 2289 2311 1.26e-2 SMART
ZnF_C2H2 2317 2340 2.02e-1 SMART
low complexity region 2361 2384 N/A INTRINSIC
ZnF_C2H2 2403 2425 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133895
SMART Domains Protein: ENSMUSP00000122775
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 4 27 5.81e-2 SMART
low complexity region 81 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.8%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to C2H2-type zinc finger family of proteins. It contains multiple C2H2-type zinc fingers and may be involved in transcriptional regulation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 210 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik TCT TCTCCT 12: 110,668,448 probably benign Het
2010300C02Rik T A 1: 37,625,035 E594V probably benign Homo
2010300C02Rik C A 1: 37,625,036 E594* probably null Homo
4930402H24Rik CC CCTGC 2: 130,770,752 probably benign Het
4932415D10Rik TTCA T 10: 82,285,469 probably benign Homo
4932438A13Rik TTATTAT TTATTATTATTATTACTATTAT 3: 37,050,754 probably benign Het
A630001G21Rik CTGTT CT 1: 85,723,135 probably benign Homo
Abcb11 C A 2: 69,243,518 R1221L probably damaging Homo
Abcb4 GAAA G 5: 8,896,597 probably benign Homo
Ahdc1 CT CTCGT 4: 133,062,759 probably benign Homo
Alpk3 TCT TCTACT 7: 81,077,762 probably benign Het
Amfr C G 8: 94,005,159 G30R probably damaging Homo
Ankrd35 GC GCTAC 3: 96,683,849 probably benign Homo
Anxa7 C T 14: 20,469,411 G113E probably damaging Homo
Apc CAATAAAGC CAATAAAGCTAATAAAGC 18: 34,281,999 probably benign Homo
Apol6 GTTT GTTTCTTT 15: 77,051,442 probably null Homo
Arpc1b GGTGGC GGTGGCGTGGC 5: 145,126,787 probably null Het
AY358078 C T 14: 51,805,698 S281L unknown Homo
BC051142 CAG CAGAAG 17: 34,460,051 probably benign Het
BC051142 GCA GCATCA 17: 34,460,068 probably benign Het
Blm ACCTGC ACCTGCCTGC 7: 80,463,771 probably null Het
Blm T TACCA 7: 80,463,774 probably null Het
Blzf1 TTGT TT 1: 164,303,917 probably null Homo
Btnl10 A AAGG 11: 58,923,931 probably benign Homo
Cacna1a ACC ACCGCC 8: 84,638,720 probably benign Het
Cacna1a ACC ACCCCC 8: 84,638,726 probably benign Homo
Catsper2 TTC TTCTTTTACTTTGTC 2: 121,397,540 probably benign Homo
Ccdc170 ACC ACCTCC 10: 4,561,023 probably benign Het
Ccdc170 AC ACCCC 10: 4,561,029 probably benign Het
Ccdc73 TAAG T 2: 104,991,840 probably benign Homo
Ccnk TTCCCAC T 12: 108,202,507 probably benign Het
Cdan1 A C 2: 120,724,971 V763G probably damaging Het
Cdk6 A G 5: 3,344,211 probably benign Het
Cdx1 TGCTGC TGCTGCCGCTGC 18: 61,019,874 probably benign Het
Cdx1 GCTGCT GCTGCTTCTGCT 18: 61,019,878 probably benign Het
Cfap46 CCTTCT CCTTCTTCT 7: 139,638,930 probably benign Homo
Chd4 GC GCTCCCCC 6: 125,122,131 probably benign Homo
Cluh CCCCGAGCC CCCCGAGCCCGAGCC 11: 74,669,514 probably benign Het
Cluh AGCCTG AGCCTGCGCCTG 11: 74,669,519 probably benign Het
Cluh GAGCCT GAGCCTAAGCCT 11: 74,669,524 probably benign Het
Cluh CC CCTGAGGC 11: 74,669,533 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,569 probably benign Het
Cntnap1 GCCCCA GCCCCAACCCCA 11: 101,189,576 probably benign Het
Cntnap1 GCCCCA GCCCCACCCCCA 11: 101,189,582 probably benign Het
Cntnap1 CCCAGC CCCAGCGCCAGC 11: 101,189,590 probably benign Het
Cul9 CTCTTC CTCTTCTTC 17: 46,500,846 probably benign Het
Cul9 CTC CTCTTC 17: 46,500,858 probably benign Het
Cyth2 C A 7: 45,813,042 S102I possibly damaging Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,686 probably benign Het
Dbr1 GGAGG GGAGGACGAGG 9: 99,583,699 probably benign Het
Dhx8 GACCGA GACCGATACCGA 11: 101,738,179 probably benign Homo
Dhx8 CGAGAC CGAGACGGAGAC 11: 101,738,182 probably benign Homo
Dhx8 GAGACC GAGACCCAGACC 11: 101,738,189 probably benign Homo
Dnah8 ACTGCCCCT ACT 17: 30,635,465 probably benign Het
Dnah8 CCTCCCG C 17: 30,635,477 probably benign Homo
Dnajb5 AGGTG A 4: 42,957,126 probably null Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Homo
E4f1 CCG CCGACG 17: 24,455,192 probably benign Homo
Eif3a TTA TTATTATA 19: 60,775,289 probably benign Het
Fam81b TTC TTCGTC 13: 76,271,319 probably benign Het
Fbxo22 G A 9: 55,209,382 R56H probably damaging Het
Fcgr1 CTTCT C 3: 96,284,504 probably null Het
Fcgr1 T C 3: 96,287,094 D159G probably benign Homo
Fmn1 CCTCCT CCTCCTACTCCT 2: 113,525,778 probably benign Het
Fmn1 CC CCCCCTGC 2: 113,525,781 probably benign Het
Fmn1 CC CCTCCTTC 2: 113,525,784 probably benign Het
G530012D18Rik GA GACAGAGATA 1: 85,577,178 probably null Het
Gli3 G A 13: 15,644,357 R248H probably damaging Het
Gm16503 G A 4: 147,541,253 G68E unknown Het
Gm19345 GGATGGCAGGTG GG 7: 19,857,602 probably null Het
Gm4340 GCA GCAACA 10: 104,196,077 probably benign Het
Gm4340 AGC AGCTGC 10: 104,196,097 probably benign Het
Gm4340 AG AGCGG 10: 104,196,100 probably benign Het
Gm6309 C T 5: 146,168,183 V307I probably benign Het
Gpatch11 AAGAGG AAGAGGCAGAGG 17: 78,842,171 probably benign Het
Gpatch11 AGGAA AGGAAGCGGAA 17: 78,842,180 probably benign Het
Hoxa10 T A 6: 52,234,186 Q250L possibly damaging Homo
Hrh1 T C 6: 114,481,123 I455T possibly damaging Het
Hspa1b GCGCC GC 17: 34,957,129 probably benign Homo
Iba57 GAAA GAAAAA 11: 59,161,505 probably null Homo
Igf1r TGGAGC TGGAGCTGGAGAGGGAGC 7: 68,226,181 probably benign Het
Il17rd CGG CGGAGG 14: 27,082,680 probably benign Het
Il2 AGGTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTGCTG 3: 37,125,764 probably benign Het
Il2 TGG TGGGGCTTGAAGCGG 3: 37,125,828 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Homo
Klra2 G GAAATCCACAT 6: 131,221,852 probably null Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,366 probably benign Het
Kmt2b CCTCCT CCTCCTTCTCCT 7: 30,586,367 probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,586,370 probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,378 probably benign Het
Krt10 TCCGCC TCCGCCGCC 11: 99,386,197 probably benign Homo
Krt10 TCCTCC TCCTCCGCCTCC 11: 99,389,273 probably benign Het
Krt10 TCC TCCTCCACC 11: 99,389,279 probably benign Homo
Krtap28-10 TCCCACA TCCCACACCCACA 1: 83,042,123 probably benign Homo
Krtap4-2 A ACAC 11: 99,635,013 probably benign Het
Krtap9-3 AC ACAGGTGTCGC 11: 99,598,004 probably benign Het
Las1l AGG AGGGGG X: 95,940,821 probably benign Het
Las1l AGG AGGCGG X: 95,940,827 probably benign Het
Las1l GAG GAGCAG X: 95,940,829 probably benign Het
Lrit3 TGC TGCAGC 3: 129,788,806 probably benign Het
Lrit3 GCT GCTTCT 3: 129,788,810 probably benign Het
Lrit3 AC ACATTC 3: 129,803,913 probably null Homo
Luzp1 A AGGTGGCCTCTTCAGT 4: 136,543,196 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,835 probably benign Het
Mamld1 GCA GCAACA X: 71,118,839 probably benign Het
Mapk8ip3 G A 17: 24,902,119 probably null Homo
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,573 probably benign Het
Nat8f2 T A 6: 85,867,686 L231F possibly damaging Homo
Nfxl1 CC CCGGGGAC 5: 72,559,121 probably benign Het
Noc2l GCT GCTTCT 4: 156,240,094 probably benign Het
Noc2l CTG CTGTTG 4: 156,240,095 probably benign Het
Noc2l GGTAG GG 4: 156,241,501 probably benign Homo
Nxpe5 C T 5: 138,229,934 probably benign Het
Olfr1038-ps CAG CAGAG 2: 86,122,760 probably null Homo
Olfr418 GGGCTGCTTGTGGCAAT G 1: 173,270,630 probably null Het
Olfr568 CT CTAATTGCCTT 7: 102,877,233 probably benign Homo
Olfr644 G C 7: 104,071,292 probably benign Homo
Olfr890 A G 9: 38,143,188 I13V probably benign Homo
Osmr C CTCA 15: 6,837,706 probably null Homo
Patl2 CTG CTGTTG 2: 122,126,136 probably benign Het
Patl2 GC GCTAC 2: 122,126,144 probably null Het
Patl2 C CTGA 2: 122,126,145 probably benign Het
Pdik1l GTTTTTGTTTT GTTTTTGTTTTTTTTTTGTTTT 4: 134,279,367 probably null Homo
Pdik1l ACCACC ACCACCCCCACC 4: 134,279,506 probably benign Het
Phc1 GCTG GCTGCTTCTG 6: 122,323,598 probably benign Het
Piezo1 G A 8: 122,495,569 R503W probably damaging Homo
Pitrm1 TTTTA T 13: 6,560,596 probably benign Homo
Pkdrej TG TGGGAGCG 15: 85,819,680 probably benign Homo
Pla2g4e AGGG A 2: 120,244,724 probably benign Homo
Plekhs1 AC ACCTCCCCCGAGCC 19: 56,479,863 probably benign Het
Pnmal1 CCTCATGATGCACCTGCTTCAACATC CCTCATGATGCACCTGCTTCAACATCTCATGATGCACCTGCTTCAACATC 7: 16,961,425 probably benign Homo
Pnmal2 TGGA T 7: 16,946,006 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Homo
Prr13 CTC CTCATC 15: 102,462,173 probably benign Het
Prss41 CACA C 17: 23,844,097 probably benign Het
Prtg GTAAC G 9: 72,857,081 probably benign Het
Ptk2b C T 14: 66,173,849 R411Q possibly damaging Homo
Ptms TCT TCTGCT 6: 124,914,457 probably benign Homo
Ptms TTC TTCGTC 6: 124,914,459 probably benign Homo
Ptms C CTTG 6: 124,914,461 probably benign Homo
Ptpn23 G T 9: 110,387,633 P1052T probably benign Homo
Rab3il1 C A 19: 10,033,751 A264E probably damaging Homo
Rbm6 GCTGT G 9: 107,782,755 probably null Homo
Rtbdn TAG TAGGGGCAG 8: 84,956,161 probably benign Het
Rtbdn AGCG AGCGTCCGCG 8: 84,956,168 probably benign Het
Rtbdn CGGC CGGCAGGGGC 8: 84,956,176 probably benign Het
Rtbdn GGC GGCAGCTGC 8: 84,956,177 probably benign Het
Sbp CAAAG CAAAGCTGCTGACAAAAAAG 17: 23,945,382 probably benign Het
Sbp G GCTGACAACAAAGATC 17: 23,945,389 probably benign Het
Setd1a GTGGTAGTG GTGGTAGTGTTGGTAGTG 7: 127,785,312 probably benign Het
Sfswap GCCCACTC GCCCACTCATCCCACTC 5: 129,569,756 probably benign Het
Six3 GGC GGCAGC 17: 85,621,357 probably benign Het
Six3 GCG GCGCCG 17: 85,621,358 probably benign Het
Six3 CGG CGGGGG 17: 85,621,362 probably benign Het
Six3 GGC GGCAGC 17: 85,621,363 probably benign Het
Six3 CGG CGGGGG 17: 85,621,365 probably benign Het
Six3 CGG CGGGGG 17: 85,621,368 probably benign Het
Slc12a1 ACC ACCTTTGGCCACAACTCC 2: 125,154,214 probably benign Homo
Smarca2 CAGCAGCAGCAGCAGCAGCA CAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,630,999 probably benign Homo
Spaca1 TCGCTC TCGCTCGCGCTC 4: 34,049,836 probably benign Het
Spag1 TTC TTCGTC 15: 36,197,733 probably benign Het
Spag17 AGG AGGCGG 3: 100,056,257 probably benign Het
Srebf2 G T 15: 82,185,335 A693S probably damaging Homo
Srpk2 T C 5: 23,545,196 probably null Homo
Sry GTG GTGTTG Y: 2,662,837 probably benign Homo
Sry TGG TGGGGG Y: 2,662,838 probably benign Homo
Sry AACTGCT A Y: 2,663,195 probably benign Het
St5 CACCACACTGGGGCAGCCCACACTGGGGCAG CCCCACACTGGGGCAG 7: 109,556,921 probably benign Het
Stard9 C CTAAGGGACTAGTAGG 2: 120,696,085 probably benign Het
Supt20 GCAGCA GCAGCAACAGCA 3: 54,727,657 probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,658 probably benign Het
Supt20 CAGCAG CAGCAGAAGCAG 3: 54,727,661 probably benign Het
Tcof1 GGGTA G 18: 60,828,650 probably benign Homo
Tdpoz3 A C 3: 93,826,674 N219H probably benign Het
Tesk1 C CCCCG 4: 43,447,004 probably null Homo
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Tob1 GCA GCAACA 11: 94,214,464 probably benign Het
Tob1 A AGCC 11: 94,214,478 probably benign Het
Trav15-2-dv6-2 AG AGAGG 14: 53,649,756 probably benign Homo
Trav15-2-dv6-2 G GAAA 14: 53,649,757 probably benign Homo
Trim63 GAGT G 4: 134,327,725 probably benign Het
Tsen2 G GAGA 6: 115,560,077 probably benign Het
Ttf2 TC TCCCC 3: 100,963,160 probably benign Homo
Tusc1 ACCGCC ACCGCCCCCGCC 4: 93,335,313 probably benign Homo
Ubqlnl TGAG T 7: 104,149,835 probably benign Homo
Ubtf CCT CCTACT 11: 102,306,948 probably null Het
Ubtf TCC TCCACC 11: 102,306,950 probably benign Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Homo
Wasf3 G T 5: 146,470,250 R460L probably damaging Het
Zc3h13 ATGTGCGAG ATGTGCGAGGTGTGCGAG 14: 75,323,596 probably benign Homo
Zc3h13 TGCGAGATG TGCGAGATGAGCGAGATG 14: 75,323,599 probably benign Homo
Zfhx3 GCAACA GCAACAACAACAACA 8: 108,956,088 probably benign Het
Zfhx3 AGCA AGCAACAGACGCA 8: 108,956,102 probably benign Het
Zfhx3 GCA GCAACAGCACCA 8: 108,956,103 probably benign Het
Zfp111 TCA TCAACA 7: 24,199,805 probably benign Homo
Zfp112 CATGA CATGATGA 7: 24,125,407 probably benign Homo
Zfp26 C A 9: 20,438,546 A241S probably benign Homo
Zfp282 CGG CGGGGG 6: 47,904,790 probably benign Het
Zfp282 CGG CGGGGG 6: 47,904,799 probably benign Het
Zfp335 CTC CTCGTC 2: 164,907,474 probably benign Het
Zfp335 TCC TCCGCC 2: 164,907,475 probably benign Het
Zfp335 TC TCCCC 2: 164,907,484 probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,776 probably benign Het
Zfp598 ACCACC ACCACCGCCACC 17: 24,680,782 probably benign Het
Zfp598 AC ACCACCGC 17: 24,680,791 probably benign Het
Zfp831 TCC TCCCCC 2: 174,645,471 probably benign Het
Zfp831 CTC CTCATC 2: 174,645,476 probably benign Het
Zfp831 TC TCCGC 2: 174,645,483 probably benign Het
Zfp93 CAGGCATAG CAG 7: 24,275,389 probably benign Homo
Zscan10 TGACG TG 17: 23,609,445 probably benign Homo
Other mutations in Zfp462
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Zfp462 APN 4 55011483 unclassified probably null
IGL00421:Zfp462 APN 4 55023576 missense probably benign 0.00
IGL00899:Zfp462 APN 4 55007732 missense probably damaging 1.00
IGL01549:Zfp462 APN 4 55013181 missense probably damaging 1.00
IGL01627:Zfp462 APN 4 55008912 missense possibly damaging 0.93
IGL01715:Zfp462 APN 4 55008586 missense probably benign 0.20
IGL01862:Zfp462 APN 4 55023441 missense probably damaging 1.00
IGL01878:Zfp462 APN 4 55010613 missense probably damaging 1.00
IGL01913:Zfp462 APN 4 55012138 missense probably benign 0.04
IGL02029:Zfp462 APN 4 55079395 splice site probably benign
IGL02338:Zfp462 APN 4 55010292 missense possibly damaging 0.88
IGL02552:Zfp462 APN 4 55010613 missense probably damaging 1.00
IGL02623:Zfp462 APN 4 55012986 missense probably damaging 1.00
IGL02750:Zfp462 APN 4 55060236 missense probably null 1.00
IGL02815:Zfp462 APN 4 55051303 missense probably damaging 1.00
IGL03204:Zfp462 APN 4 55080785 missense possibly damaging 0.80
FR4304:Zfp462 UTSW 4 55009757 unclassified probably benign
FR4304:Zfp462 UTSW 4 55009758 unclassified probably benign
FR4737:Zfp462 UTSW 4 55009758 unclassified probably benign
FR4976:Zfp462 UTSW 4 55009760 unclassified probably benign
FR4976:Zfp462 UTSW 4 55009761 unclassified probably benign
P0035:Zfp462 UTSW 4 55009086 missense probably benign
R0052:Zfp462 UTSW 4 55011762 missense probably benign 0.03
R0143:Zfp462 UTSW 4 55023402 splice site probably benign
R0145:Zfp462 UTSW 4 55010529 missense probably damaging 1.00
R0315:Zfp462 UTSW 4 55079314 missense probably damaging 0.99
R0349:Zfp462 UTSW 4 55008768 missense probably benign
R0359:Zfp462 UTSW 4 55013689 missense probably damaging 1.00
R0413:Zfp462 UTSW 4 55010534 missense probably damaging 0.99
R0554:Zfp462 UTSW 4 55013689 missense probably damaging 1.00
R0616:Zfp462 UTSW 4 55011951 missense probably damaging 1.00
R0631:Zfp462 UTSW 4 55007563 start codon destroyed possibly damaging 0.60
R1086:Zfp462 UTSW 4 55013000 missense probably damaging 1.00
R1499:Zfp462 UTSW 4 55060046 missense probably damaging 1.00
R1509:Zfp462 UTSW 4 55007667 missense probably damaging 1.00
R1526:Zfp462 UTSW 4 55009002 missense probably benign
R1541:Zfp462 UTSW 4 55008928 missense possibly damaging 0.53
R1691:Zfp462 UTSW 4 55013489 missense possibly damaging 0.70
R1843:Zfp462 UTSW 4 55010010 missense possibly damaging 0.88
R2086:Zfp462 UTSW 4 55010830 missense probably damaging 1.00
R2109:Zfp462 UTSW 4 55008496 missense probably benign 0.00
R2148:Zfp462 UTSW 4 55013670 missense probably benign 0.01
R2179:Zfp462 UTSW 4 55009524 missense possibly damaging 0.73
R2325:Zfp462 UTSW 4 55013712 missense probably benign
R2352:Zfp462 UTSW 4 55008313 missense probably null
R2566:Zfp462 UTSW 4 55008522 missense probably benign 0.00
R3879:Zfp462 UTSW 4 55060095 missense probably damaging 1.00
R3969:Zfp462 UTSW 4 55012402 missense probably damaging 1.00
R4273:Zfp462 UTSW 4 55008411 missense probably benign 0.00
R4413:Zfp462 UTSW 4 55012672 missense probably damaging 0.99
R4510:Zfp462 UTSW 4 55008934 missense possibly damaging 0.86
R4511:Zfp462 UTSW 4 55008934 missense possibly damaging 0.86
R4609:Zfp462 UTSW 4 55011889 missense probably damaging 1.00
R4632:Zfp462 UTSW 4 55012981 missense probably damaging 1.00
R4649:Zfp462 UTSW 4 55009349 missense probably benign
R4682:Zfp462 UTSW 4 55011376 missense probably damaging 1.00
R4696:Zfp462 UTSW 4 55008612 missense probably benign
R4744:Zfp462 UTSW 4 55011598 missense probably damaging 1.00
R4747:Zfp462 UTSW 4 55013476 missense probably benign 0.00
R4819:Zfp462 UTSW 4 55060044 missense probably damaging 1.00
R4827:Zfp462 UTSW 4 55012213 missense probably damaging 1.00
R4854:Zfp462 UTSW 4 55010668 missense probably damaging 1.00
R4879:Zfp462 UTSW 4 55009444 missense probably benign 0.02
R4891:Zfp462 UTSW 4 55060055 missense probably damaging 1.00
R4993:Zfp462 UTSW 4 55051204 missense possibly damaging 0.62
R5118:Zfp462 UTSW 4 55010667 missense probably damaging 1.00
R5171:Zfp462 UTSW 4 55016986 splice site probably null
R5173:Zfp462 UTSW 4 55011115 missense probably damaging 0.99
R5221:Zfp462 UTSW 4 55016887 missense possibly damaging 0.86
R5268:Zfp462 UTSW 4 55012299 missense probably benign
R5314:Zfp462 UTSW 4 55013178 missense probably damaging 1.00
R5429:Zfp462 UTSW 4 55060077 missense probably damaging 1.00
R5518:Zfp462 UTSW 4 55009818 missense probably damaging 0.99
R5525:Zfp462 UTSW 4 55050281 missense possibly damaging 0.73
R5620:Zfp462 UTSW 4 55013464 missense probably benign 0.01
R5775:Zfp462 UTSW 4 55010590 missense probably damaging 0.99
R6126:Zfp462 UTSW 4 55023573 missense probably benign 0.01
R6280:Zfp462 UTSW 4 55010253 missense probably benign 0.00
R6325:Zfp462 UTSW 4 55080680 missense probably benign 0.04
R6542:Zfp462 UTSW 4 55023433 missense probably damaging 1.00
R6612:Zfp462 UTSW 4 55012324 unclassified probably null
R6663:Zfp462 UTSW 4 55008933 missense possibly damaging 0.53
R6872:Zfp462 UTSW 4 55012326 missense probably benign 0.01
R6889:Zfp462 UTSW 4 55007671 missense probably damaging 1.00
R6896:Zfp462 UTSW 4 55009544 missense possibly damaging 0.72
R6913:Zfp462 UTSW 4 55007775 missense probably benign 0.25
R6988:Zfp462 UTSW 4 55080716 missense probably benign 0.00
R7131:Zfp462 UTSW 4 55009380 missense not run
R7151:Zfp462 UTSW 4 55051271 missense not run
Predicted Primers PCR Primer
(F):5'- GAAAGCCTGTCTTCCTCGTTG -3'
(R):5'- TATCCGTCTCATTTTCCAGTGGTAG -3'

Sequencing Primer
(F):5'- CCTCGTTGAATGAAGGAATGGTATC -3'
(R):5'- CTCATTTTCCAGTGGTAGGCTCG -3'
Posted On2018-04-05