Incidental Mutation 'FR4737:Chd4'
ID511645
Institutional Source Beutler Lab
Gene Symbol Chd4
Ensembl Gene ENSMUSG00000063870
Gene Namechromodomain helicase DNA binding protein 4
SynonymsD6Ertd380e, Mi-2beta, 9530019N15Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.976) question?
Stock #FR4737 ()
Quality Score144.466
Status Not validated
Chromosome6
Chromosomal Location125095981-125130591 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GC to GCTCCCCC at 125122131 bp
ZygosityHomozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056889] [ENSMUST00000112390] [ENSMUST00000112392] [ENSMUST00000124317]
Predicted Effect probably benign
Transcript: ENSMUST00000056889
SMART Domains Protein: ENSMUSP00000060054
Gene: ENSMUSG00000063870

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
low complexity region 107 144 N/A INTRINSIC
Pfam:CHDNT 156 210 7.7e-35 PFAM
low complexity region 217 249 N/A INTRINSIC
low complexity region 271 291 N/A INTRINSIC
low complexity region 296 318 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
PHD 365 408 7.17e-15 SMART
RING 366 407 7.46e-1 SMART
low complexity region 424 443 N/A INTRINSIC
PHD 444 487 4.41e-15 SMART
RING 445 486 2.63e0 SMART
CHROMO 492 572 8.11e-17 SMART
CHROMO 613 670 1.98e-11 SMART
low complexity region 675 694 N/A INTRINSIC
DEXDc 715 927 2.73e-37 SMART
low complexity region 1044 1056 N/A INTRINSIC
HELICc 1073 1157 7.61e-27 SMART
DUF1087 1282 1346 5.56e-33 SMART
DUF1086 1359 1516 4.05e-108 SMART
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1590 1633 N/A INTRINSIC
low complexity region 1635 1653 N/A INTRINSIC
low complexity region 1661 1674 N/A INTRINSIC
Pfam:CHDCT2 1727 1899 1.9e-98 PFAM
low complexity region 1903 1915 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112390
SMART Domains Protein: ENSMUSP00000108009
Gene: ENSMUSG00000063870

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 114 151 N/A INTRINSIC
Pfam:CHDNT 164 217 2e-28 PFAM
low complexity region 224 256 N/A INTRINSIC
low complexity region 278 298 N/A INTRINSIC
low complexity region 303 325 N/A INTRINSIC
low complexity region 328 354 N/A INTRINSIC
PHD 372 415 7.17e-15 SMART
RING 373 414 7.46e-1 SMART
low complexity region 431 450 N/A INTRINSIC
PHD 451 494 4.41e-15 SMART
RING 452 493 2.63e0 SMART
CHROMO 499 579 8.11e-17 SMART
CHROMO 620 677 1.98e-11 SMART
low complexity region 682 701 N/A INTRINSIC
DEXDc 722 934 2.73e-37 SMART
low complexity region 1051 1063 N/A INTRINSIC
HELICc 1080 1164 7.61e-27 SMART
DUF1087 1289 1353 5.56e-33 SMART
DUF1086 1366 1523 4.05e-108 SMART
low complexity region 1533 1547 N/A INTRINSIC
low complexity region 1567 1585 N/A INTRINSIC
low complexity region 1597 1640 N/A INTRINSIC
low complexity region 1642 1660 N/A INTRINSIC
low complexity region 1668 1681 N/A INTRINSIC
Pfam:CHDCT2 1735 1906 4.3e-90 PFAM
low complexity region 1910 1922 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112392
SMART Domains Protein: ENSMUSP00000108011
Gene: ENSMUSG00000063870

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
low complexity region 107 144 N/A INTRINSIC
Pfam:CHDNT 156 210 1.1e-34 PFAM
low complexity region 217 249 N/A INTRINSIC
low complexity region 271 291 N/A INTRINSIC
low complexity region 296 318 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
PHD 352 395 7.17e-15 SMART
RING 353 394 7.46e-1 SMART
low complexity region 411 430 N/A INTRINSIC
PHD 431 474 4.41e-15 SMART
RING 432 473 2.63e0 SMART
CHROMO 479 559 8.11e-17 SMART
CHROMO 600 657 1.98e-11 SMART
low complexity region 662 681 N/A INTRINSIC
DEXDc 702 914 2.73e-37 SMART
low complexity region 1031 1043 N/A INTRINSIC
HELICc 1060 1144 7.61e-27 SMART
DUF1087 1269 1333 5.56e-33 SMART
DUF1086 1346 1503 4.05e-108 SMART
low complexity region 1513 1527 N/A INTRINSIC
low complexity region 1547 1565 N/A INTRINSIC
low complexity region 1577 1620 N/A INTRINSIC
low complexity region 1622 1640 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
Pfam:CHDCT2 1714 1886 2.8e-98 PFAM
low complexity region 1890 1902 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124317
SMART Domains Protein: ENSMUSP00000120704
Gene: ENSMUSG00000063870

DomainStartEndE-ValueType
PDB:3MWY|W 1 137 2e-13 PDB
DUF1087 141 205 5.56e-33 SMART
low complexity region 209 221 N/A INTRINSIC
DUF1086 246 403 4.05e-108 SMART
low complexity region 413 427 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157583
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.8%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the SNF2/RAD54 helicase family. It represents the main component of the nucleosome remodeling and deacetylase complex and plays an important role in epigenetic transcriptional repression. Patients with dermatomyositis develop antibodies against this protein. Somatic mutations in this gene are associated with serous endometrial tumors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality between E3.5 and E4.5, absent blastocoele failure of trophectoderm function and increased apoptosis in blastocysts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 211 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik TCT TCTCCT 12: 110,668,448 probably benign Het
2010300C02Rik T A 1: 37,625,035 E594V probably benign Homo
2010300C02Rik C A 1: 37,625,036 E594* probably null Homo
4930402H24Rik CC CCTGC 2: 130,770,752 probably benign Het
4932415D10Rik TTCA T 10: 82,285,469 probably benign Homo
4932438A13Rik TTATTAT TTATTATTATTATTACTATTAT 3: 37,050,754 probably benign Het
A630001G21Rik CTGTT CT 1: 85,723,135 probably benign Homo
Abcb11 C A 2: 69,243,518 R1221L probably damaging Homo
Abcb4 GAAA G 5: 8,896,597 probably benign Homo
Ahdc1 CT CTCGT 4: 133,062,759 probably benign Homo
Alpk3 TCT TCTACT 7: 81,077,762 probably benign Het
Amfr C G 8: 94,005,159 G30R probably damaging Homo
Ankrd35 GC GCTAC 3: 96,683,849 probably benign Homo
Anxa7 C T 14: 20,469,411 G113E probably damaging Homo
Apc CAATAAAGC CAATAAAGCTAATAAAGC 18: 34,281,999 probably benign Homo
Apol6 GTTT GTTTCTTT 15: 77,051,442 probably null Homo
Arpc1b GGTGGC GGTGGCGTGGC 5: 145,126,787 probably null Het
AY358078 C T 14: 51,805,698 S281L unknown Homo
BC051142 CAG CAGAAG 17: 34,460,051 probably benign Het
BC051142 GCA GCATCA 17: 34,460,068 probably benign Het
Blm ACCTGC ACCTGCCTGC 7: 80,463,771 probably null Het
Blm T TACCA 7: 80,463,774 probably null Het
Blzf1 TTGT TT 1: 164,303,917 probably null Homo
Btnl10 A AAGG 11: 58,923,931 probably benign Homo
Cacna1a ACC ACCGCC 8: 84,638,720 probably benign Het
Cacna1a ACC ACCCCC 8: 84,638,726 probably benign Homo
Catsper2 TTC TTCTTTTACTTTGTC 2: 121,397,540 probably benign Homo
Ccdc170 ACC ACCTCC 10: 4,561,023 probably benign Het
Ccdc170 AC ACCCC 10: 4,561,029 probably benign Het
Ccdc73 TAAG T 2: 104,991,840 probably benign Homo
Ccnk TTCCCAC T 12: 108,202,507 probably benign Het
Cdan1 A C 2: 120,724,971 V763G probably damaging Het
Cdk6 A G 5: 3,344,211 probably benign Het
Cdx1 TGCTGC TGCTGCCGCTGC 18: 61,019,874 probably benign Het
Cdx1 GCTGCT GCTGCTTCTGCT 18: 61,019,878 probably benign Het
Cfap46 CCTTCT CCTTCTTCT 7: 139,638,930 probably benign Homo
Cluh CCCCGAGCC CCCCGAGCCCGAGCC 11: 74,669,514 probably benign Het
Cluh AGCCTG AGCCTGCGCCTG 11: 74,669,519 probably benign Het
Cluh GAGCCT GAGCCTAAGCCT 11: 74,669,524 probably benign Het
Cluh CC CCTGAGGC 11: 74,669,533 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,569 probably benign Het
Cntnap1 GCCCCA GCCCCAACCCCA 11: 101,189,576 probably benign Het
Cntnap1 GCCCCA GCCCCACCCCCA 11: 101,189,582 probably benign Het
Cntnap1 CCCAGC CCCAGCGCCAGC 11: 101,189,590 probably benign Het
Cul9 CTCTTC CTCTTCTTC 17: 46,500,846 probably benign Het
Cul9 CTC CTCTTC 17: 46,500,858 probably benign Het
Cyth2 C A 7: 45,813,042 S102I possibly damaging Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,686 probably benign Het
Dbr1 GGAGG GGAGGACGAGG 9: 99,583,699 probably benign Het
Dhx8 GACCGA GACCGATACCGA 11: 101,738,179 probably benign Homo
Dhx8 CGAGAC CGAGACGGAGAC 11: 101,738,182 probably benign Homo
Dhx8 GAGACC GAGACCCAGACC 11: 101,738,189 probably benign Homo
Dnah8 ACTGCCCCT ACT 17: 30,635,465 probably benign Het
Dnah8 CCTCCCG C 17: 30,635,477 probably benign Homo
Dnajb5 AGGTG A 4: 42,957,126 probably null Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Homo
E4f1 CCG CCGACG 17: 24,455,192 probably benign Homo
Eif3a TTA TTATTATA 19: 60,775,289 probably benign Het
Fam81b TTC TTCGTC 13: 76,271,319 probably benign Het
Fbxo22 G A 9: 55,209,382 R56H probably damaging Het
Fcgr1 CTTCT C 3: 96,284,504 probably null Het
Fcgr1 T C 3: 96,287,094 D159G probably benign Homo
Fmn1 CCTCCT CCTCCTACTCCT 2: 113,525,778 probably benign Het
Fmn1 CC CCCCCTGC 2: 113,525,781 probably benign Het
Fmn1 CC CCTCCTTC 2: 113,525,784 probably benign Het
G530012D18Rik GA GACAGAGATA 1: 85,577,178 probably null Het
Gli3 G A 13: 15,644,357 R248H probably damaging Het
Gm16503 G A 4: 147,541,253 G68E unknown Het
Gm19345 GGATGGCAGGTG GG 7: 19,857,602 probably null Het
Gm4340 GCA GCAACA 10: 104,196,077 probably benign Het
Gm4340 AGC AGCTGC 10: 104,196,097 probably benign Het
Gm4340 AG AGCGG 10: 104,196,100 probably benign Het
Gm6309 C T 5: 146,168,183 V307I probably benign Het
Gpatch11 AAGAGG AAGAGGCAGAGG 17: 78,842,171 probably benign Het
Gpatch11 AGGAA AGGAAGCGGAA 17: 78,842,180 probably benign Het
Hoxa10 T A 6: 52,234,186 Q250L possibly damaging Homo
Hrh1 T C 6: 114,481,123 I455T possibly damaging Het
Hspa1b GCGCC GC 17: 34,957,129 probably benign Homo
Iba57 GAAA GAAAAA 11: 59,161,505 probably null Homo
Igf1r TGGAGC TGGAGCTGGAGAGGGAGC 7: 68,226,181 probably benign Het
Il17rd CGG CGGAGG 14: 27,082,680 probably benign Het
Il2 AGGTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTGCTG 3: 37,125,764 probably benign Het
Il2 TGG TGGGGCTTGAAGCGG 3: 37,125,828 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Homo
Klra2 G GAAATCCACAT 6: 131,221,852 probably null Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,366 probably benign Het
Kmt2b CCTCCT CCTCCTTCTCCT 7: 30,586,367 probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,586,370 probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,378 probably benign Het
Krt10 TCCGCC TCCGCCGCC 11: 99,386,197 probably benign Homo
Krt10 TCCTCC TCCTCCGCCTCC 11: 99,389,273 probably benign Het
Krt10 TCC TCCTCCACC 11: 99,389,279 probably benign Homo
Krtap28-10 TCCCACA TCCCACACCCACA 1: 83,042,123 probably benign Homo
Krtap4-2 A ACAC 11: 99,635,013 probably benign Het
Krtap9-3 AC ACAGGTGTCGC 11: 99,598,004 probably benign Het
Las1l AGG AGGGGG X: 95,940,821 probably benign Het
Las1l AGG AGGCGG X: 95,940,827 probably benign Het
Las1l GAG GAGCAG X: 95,940,829 probably benign Het
Lrit3 TGC TGCAGC 3: 129,788,806 probably benign Het
Lrit3 GCT GCTTCT 3: 129,788,810 probably benign Het
Lrit3 AC ACATTC 3: 129,803,913 probably null Homo
Luzp1 A AGGTGGCCTCTTCAGT 4: 136,543,196 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,835 probably benign Het
Mamld1 GCA GCAACA X: 71,118,839 probably benign Het
Mapk8ip3 G A 17: 24,902,119 probably null Homo
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,573 probably benign Het
Nat8f2 T A 6: 85,867,686 L231F possibly damaging Homo
Nfxl1 CC CCGGGGAC 5: 72,559,121 probably benign Het
Noc2l GCT GCTTCT 4: 156,240,094 probably benign Het
Noc2l CTG CTGTTG 4: 156,240,095 probably benign Het
Noc2l GGTAG GG 4: 156,241,501 probably benign Homo
Nxpe5 C T 5: 138,229,934 probably benign Het
Olfr1038-ps CAG CAGAG 2: 86,122,760 probably null Homo
Olfr418 GGGCTGCTTGTGGCAAT G 1: 173,270,630 probably null Het
Olfr568 CT CTAATTGCCTT 7: 102,877,233 probably benign Homo
Olfr644 G C 7: 104,071,292 probably benign Homo
Olfr890 A G 9: 38,143,188 I13V probably benign Homo
Osmr C CTCA 15: 6,837,706 probably null Homo
Patl2 CTG CTGTTG 2: 122,126,136 probably benign Het
Patl2 GC GCTAC 2: 122,126,144 probably null Het
Patl2 C CTGA 2: 122,126,145 probably benign Het
Pdik1l GTTTTTGTTTT GTTTTTGTTTTTTTTTTGTTTT 4: 134,279,367 probably null Homo
Pdik1l ACCACC ACCACCCCCACC 4: 134,279,506 probably benign Het
Phc1 GCTG GCTGCTTCTG 6: 122,323,598 probably benign Het
Piezo1 G A 8: 122,495,569 R503W probably damaging Homo
Pitrm1 TTTTA T 13: 6,560,596 probably benign Homo
Pkdrej TG TGGGAGCG 15: 85,819,680 probably benign Homo
Pla2g4e AGGG A 2: 120,244,724 probably benign Homo
Plekhs1 AC ACCTCCCCCGAGCC 19: 56,479,863 probably benign Het
Pnmal1 CCTCATGATGCACCTGCTTCAACATC CCTCATGATGCACCTGCTTCAACATCTCATGATGCACCTGCTTCAACATC 7: 16,961,425 probably benign Homo
Pnmal2 TGGA T 7: 16,946,006 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Homo
Prr13 CTC CTCATC 15: 102,462,173 probably benign Het
Prss41 CACA C 17: 23,844,097 probably benign Het
Prtg GTAAC G 9: 72,857,081 probably benign Het
Ptk2b C T 14: 66,173,849 R411Q possibly damaging Homo
Ptms TCT TCTGCT 6: 124,914,457 probably benign Homo
Ptms TTC TTCGTC 6: 124,914,459 probably benign Homo
Ptms C CTTG 6: 124,914,461 probably benign Homo
Ptpn23 G T 9: 110,387,633 P1052T probably benign Homo
Rab3il1 C A 19: 10,033,751 A264E probably damaging Homo
Rbm6 GCTGT G 9: 107,782,755 probably null Homo
Rtbdn TAG TAGGGGCAG 8: 84,956,161 probably benign Het
Rtbdn AGCG AGCGTCCGCG 8: 84,956,168 probably benign Het
Rtbdn CGGC CGGCAGGGGC 8: 84,956,176 probably benign Het
Rtbdn GGC GGCAGCTGC 8: 84,956,177 probably benign Het
Sbp CAAAG CAAAGCTGCTGACAAAAAAG 17: 23,945,382 probably benign Het
Sbp G GCTGACAACAAAGATC 17: 23,945,389 probably benign Het
Setd1a GTGGTAGTG GTGGTAGTGTTGGTAGTG 7: 127,785,312 probably benign Het
Sfswap GCCCACTC GCCCACTCATCCCACTC 5: 129,569,756 probably benign Het
Six3 GGC GGCAGC 17: 85,621,357 probably benign Het
Six3 GCG GCGCCG 17: 85,621,358 probably benign Het
Six3 CGG CGGGGG 17: 85,621,362 probably benign Het
Six3 GGC GGCAGC 17: 85,621,363 probably benign Het
Six3 CGG CGGGGG 17: 85,621,365 probably benign Het
Six3 CGG CGGGGG 17: 85,621,368 probably benign Het
Slc12a1 ACC ACCTTTGGCCACAACTCC 2: 125,154,214 probably benign Homo
Smarca2 CAGCAGCAGCAGCAGCAGCA CAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,630,999 probably benign Homo
Spaca1 TCGCTC TCGCTCGCGCTC 4: 34,049,836 probably benign Het
Spag1 TTC TTCGTC 15: 36,197,733 probably benign Het
Spag17 AGG AGGCGG 3: 100,056,257 probably benign Het
Srebf2 G T 15: 82,185,335 A693S probably damaging Homo
Srpk2 T C 5: 23,545,196 probably null Homo
Sry GTG GTGTTG Y: 2,662,837 probably benign Homo
Sry TGG TGGGGG Y: 2,662,838 probably benign Homo
Sry AACTGCT A Y: 2,663,195 probably benign Het
St5 CACCACACTGGGGCAGCCCACACTGGGGCAG CCCCACACTGGGGCAG 7: 109,556,921 probably benign Het
Stard9 C CTAAGGGACTAGTAGG 2: 120,696,085 probably benign Het
Supt20 GCAGCA GCAGCAACAGCA 3: 54,727,657 probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,658 probably benign Het
Supt20 CAGCAG CAGCAGAAGCAG 3: 54,727,661 probably benign Het
Tcof1 GGGTA G 18: 60,828,650 probably benign Homo
Tdpoz3 A C 3: 93,826,674 N219H probably benign Het
Tesk1 C CCCCG 4: 43,447,004 probably null Homo
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Tob1 GCA GCAACA 11: 94,214,464 probably benign Het
Tob1 A AGCC 11: 94,214,478 probably benign Het
Trav15-2-dv6-2 AG AGAGG 14: 53,649,756 probably benign Homo
Trav15-2-dv6-2 G GAAA 14: 53,649,757 probably benign Homo
Trim63 GAGT G 4: 134,327,725 probably benign Het
Tsen2 G GAGA 6: 115,560,077 probably benign Het
Ttf2 TC TCCCC 3: 100,963,160 probably benign Homo
Tusc1 ACCGCC ACCGCCCCCGCC 4: 93,335,313 probably benign Homo
Ubqlnl TGAG T 7: 104,149,835 probably benign Homo
Ubtf CCT CCTACT 11: 102,306,948 probably null Het
Ubtf TCC TCCACC 11: 102,306,950 probably benign Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Homo
Wasf3 G T 5: 146,470,250 R460L probably damaging Het
Zc3h13 ATGTGCGAG ATGTGCGAGGTGTGCGAG 14: 75,323,596 probably benign Homo
Zc3h13 TGCGAGATG TGCGAGATGAGCGAGATG 14: 75,323,599 probably benign Homo
Zfhx3 GCAACA GCAACAACAACAACA 8: 108,956,088 probably benign Het
Zfhx3 AGCA AGCAACAGACGCA 8: 108,956,102 probably benign Het
Zfhx3 GCA GCAACAGCACCA 8: 108,956,103 probably benign Het
Zfp111 TCA TCAACA 7: 24,199,805 probably benign Homo
Zfp112 CATGA CATGATGA 7: 24,125,407 probably benign Homo
Zfp26 C A 9: 20,438,546 A241S probably benign Homo
Zfp282 CGG CGGGGG 6: 47,904,790 probably benign Het
Zfp282 CGG CGGGGG 6: 47,904,799 probably benign Het
Zfp335 CTC CTCGTC 2: 164,907,474 probably benign Het
Zfp335 TCC TCCGCC 2: 164,907,475 probably benign Het
Zfp335 TC TCCCC 2: 164,907,484 probably benign Het
Zfp462 CCACC CCACCTCAGCCACAGTCACC 4: 55,009,758 probably benign Het
Zfp462 ACC ACCTCAGCCACAGTCGCC 4: 55,009,760 probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,776 probably benign Het
Zfp598 ACCACC ACCACCGCCACC 17: 24,680,782 probably benign Het
Zfp598 AC ACCACCGC 17: 24,680,791 probably benign Het
Zfp831 TCC TCCCCC 2: 174,645,471 probably benign Het
Zfp831 CTC CTCATC 2: 174,645,476 probably benign Het
Zfp831 TC TCCGC 2: 174,645,483 probably benign Het
Zfp93 CAGGCATAG CAG 7: 24,275,389 probably benign Homo
Zscan10 TGACG TG 17: 23,609,445 probably benign Homo
Other mutations in Chd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Chd4 APN 6 125109897 missense probably damaging 1.00
IGL00917:Chd4 APN 6 125104946 missense possibly damaging 0.95
IGL01088:Chd4 APN 6 125122468 unclassified probably benign
IGL02005:Chd4 APN 6 125128816 missense possibly damaging 0.71
IGL02405:Chd4 APN 6 125097227 missense probably benign 0.06
IGL02707:Chd4 APN 6 125108767 missense probably damaging 1.00
IGL02976:Chd4 APN 6 125121368 missense probably damaging 1.00
IGL03001:Chd4 APN 6 125101566 missense possibly damaging 0.93
FR4304:Chd4 UTSW 6 125122144 unclassified probably benign
FR4589:Chd4 UTSW 6 125122133 missense probably benign 0.02
FR4589:Chd4 UTSW 6 125122139 unclassified probably benign
FR4976:Chd4 UTSW 6 125122131 unclassified probably benign
R0311:Chd4 UTSW 6 125101665 missense probably benign 0.15
R0414:Chd4 UTSW 6 125107480 missense probably damaging 1.00
R0647:Chd4 UTSW 6 125109123 missense probably damaging 1.00
R0656:Chd4 UTSW 6 125102967 missense probably damaging 0.98
R1342:Chd4 UTSW 6 125097188 missense probably benign 0.40
R1651:Chd4 UTSW 6 125123584 missense possibly damaging 0.92
R1850:Chd4 UTSW 6 125121656 missense probably damaging 1.00
R2190:Chd4 UTSW 6 125114297 missense probably benign 0.18
R2192:Chd4 UTSW 6 125105357 missense probably damaging 0.99
R2858:Chd4 UTSW 6 125104886 missense probably damaging 0.99
R3406:Chd4 UTSW 6 125122007 missense probably benign 0.09
R3431:Chd4 UTSW 6 125120560 splice site probably benign
R4330:Chd4 UTSW 6 125101602 missense probably benign 0.29
R4394:Chd4 UTSW 6 125121618 missense probably damaging 0.99
R4538:Chd4 UTSW 6 125120686 missense probably damaging 0.99
R4664:Chd4 UTSW 6 125101502 missense possibly damaging 0.58
R4805:Chd4 UTSW 6 125128945 missense possibly damaging 0.86
R5050:Chd4 UTSW 6 125107480 missense probably damaging 1.00
R5055:Chd4 UTSW 6 125100986 missense possibly damaging 0.65
R5232:Chd4 UTSW 6 125121310 missense probably damaging 1.00
R5314:Chd4 UTSW 6 125100588 missense probably damaging 0.96
R5343:Chd4 UTSW 6 125120363 missense probably damaging 1.00
R5502:Chd4 UTSW 6 125105276 missense possibly damaging 0.83
R5613:Chd4 UTSW 6 125120546 missense probably damaging 0.99
R6211:Chd4 UTSW 6 125101285 missense possibly damaging 0.82
R6606:Chd4 UTSW 6 125109426 missense probably damaging 0.99
R6753:Chd4 UTSW 6 125114300 missense probably benign 0.01
R6808:Chd4 UTSW 6 125122123 missense possibly damaging 0.53
R6939:Chd4 UTSW 6 125106538 missense probably damaging 0.99
R6968:Chd4 UTSW 6 125108318 missense probably damaging 1.00
R6973:Chd4 UTSW 6 125122862 missense possibly damaging 0.53
R6992:Chd4 UTSW 6 125114376 missense probably benign 0.14
R7058:Chd4 UTSW 6 125108442 missense possibly damaging 0.74
R7081:Chd4 UTSW 6 125129985 missense not run
X0025:Chd4 UTSW 6 125106467 nonsense probably null
X0027:Chd4 UTSW 6 125102164 missense probably damaging 0.98
X0063:Chd4 UTSW 6 125114015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATGACATGGCCTCTGAC -3'
(R):5'- TACAGAGCGGCCTTCAGTTG -3'

Sequencing Primer
(F):5'- ACATGGCCTCTGACCCAGG -3'
(R):5'- GCGGCCTTCAGTTGCTCATATTTAC -3'
Posted On2018-04-05