Incidental Mutation 'FR4737:Cacna1a'
ID511669
Institutional Source Beutler Lab
Gene Symbol Cacna1a
Ensembl Gene ENSMUSG00000034656
Gene Namecalcium channel, voltage-dependent, P/Q type, alpha 1A subunit
SynonymsCacnl1a4, alpha1A, SCA6, nmf352, Ccha1a
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.775) question?
Stock #FR4737 ()
Quality Score214.458
Status Not validated
Chromosome8
Chromosomal Location84388440-84640246 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) ACC to ACCCCC at 84638726 bp
ZygosityHomozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000121390] [ENSMUST00000122053]
Predicted Effect probably benign
Transcript: ENSMUST00000121390
SMART Domains Protein: ENSMUSP00000112436
Gene: ENSMUSG00000034656

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 99 373 1.5e-69 PFAM
Pfam:Ion_trans 488 727 1.2e-54 PFAM
Pfam:PKD_channel 578 721 6.6e-8 PFAM
low complexity region 920 959 N/A INTRINSIC
low complexity region 977 987 N/A INTRINSIC
low complexity region 1074 1093 N/A INTRINSIC
low complexity region 1143 1168 N/A INTRINSIC
Pfam:Ion_trans 1194 1472 4.9e-64 PFAM
Pfam:Ion_trans 1516 1773 2.8e-64 PFAM
Pfam:GPHH 1775 1844 5.6e-39 PFAM
Ca_chan_IQ 1899 1933 1.8e-12 SMART
AT_hook 2053 2065 2.02e0 SMART
low complexity region 2101 2113 N/A INTRINSIC
low complexity region 2153 2179 N/A INTRINSIC
low complexity region 2213 2236 N/A INTRINSIC
low complexity region 2253 2282 N/A INTRINSIC
low complexity region 2314 2325 N/A INTRINSIC
low complexity region 2342 2357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122053
SMART Domains Protein: ENSMUSP00000114055
Gene: ENSMUSG00000034656

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 91 314 4.5e-58 PFAM
PDB:4DEX|B 317 427 5e-45 PDB
Pfam:Ion_trans 476 668 6.4e-46 PFAM
Pfam:PKD_channel 530 675 7.7e-8 PFAM
low complexity region 873 912 N/A INTRINSIC
low complexity region 930 940 N/A INTRINSIC
low complexity region 1027 1046 N/A INTRINSIC
low complexity region 1096 1121 N/A INTRINSIC
Pfam:Ion_trans 1183 1414 2.8e-54 PFAM
Pfam:Ion_trans 1504 1714 3.2e-60 PFAM
Ca_chan_IQ 1852 1886 1.8e-12 SMART
AT_hook 2006 2018 2.02e0 SMART
low complexity region 2054 2066 N/A INTRINSIC
low complexity region 2106 2132 N/A INTRINSIC
low complexity region 2166 2189 N/A INTRINSIC
low complexity region 2206 2235 N/A INTRINSIC
low complexity region 2267 2278 N/A INTRINSIC
low complexity region 2295 2310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144879
Predicted Effect probably benign
Transcript: ENSMUST00000215756
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.8%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for different mutant alleles are characterized by variably severe wobbly gait beginning prior to weaning, ataxia, episodic dyskinesia, cerebellar atrophy, and absence epilepsy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 210 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik TCT TCTCCT 12: 110,668,448 probably benign Het
2010300C02Rik T A 1: 37,625,035 E594V probably benign Homo
2010300C02Rik C A 1: 37,625,036 E594* probably null Homo
4930402H24Rik CC CCTGC 2: 130,770,752 probably benign Het
4932415D10Rik TTCA T 10: 82,285,469 probably benign Homo
4932438A13Rik TTATTAT TTATTATTATTATTACTATTAT 3: 37,050,754 probably benign Het
A630001G21Rik CTGTT CT 1: 85,723,135 probably benign Homo
Abcb11 C A 2: 69,243,518 R1221L probably damaging Homo
Abcb4 GAAA G 5: 8,896,597 probably benign Homo
Ahdc1 CT CTCGT 4: 133,062,759 probably benign Homo
Alpk3 TCT TCTACT 7: 81,077,762 probably benign Het
Amfr C G 8: 94,005,159 G30R probably damaging Homo
Ankrd35 GC GCTAC 3: 96,683,849 probably benign Homo
Anxa7 C T 14: 20,469,411 G113E probably damaging Homo
Apc CAATAAAGC CAATAAAGCTAATAAAGC 18: 34,281,999 probably benign Homo
Apol6 GTTT GTTTCTTT 15: 77,051,442 probably null Homo
Arpc1b GGTGGC GGTGGCGTGGC 5: 145,126,787 probably null Het
AY358078 C T 14: 51,805,698 S281L unknown Homo
BC051142 CAG CAGAAG 17: 34,460,051 probably benign Het
BC051142 GCA GCATCA 17: 34,460,068 probably benign Het
Blm ACCTGC ACCTGCCTGC 7: 80,463,771 probably null Het
Blm T TACCA 7: 80,463,774 probably null Het
Blzf1 TTGT TT 1: 164,303,917 probably null Homo
Btnl10 A AAGG 11: 58,923,931 probably benign Homo
Catsper2 TTC TTCTTTTACTTTGTC 2: 121,397,540 probably benign Homo
Ccdc170 ACC ACCTCC 10: 4,561,023 probably benign Het
Ccdc170 AC ACCCC 10: 4,561,029 probably benign Het
Ccdc73 TAAG T 2: 104,991,840 probably benign Homo
Ccnk TTCCCAC T 12: 108,202,507 probably benign Het
Cdan1 A C 2: 120,724,971 V763G probably damaging Het
Cdk6 A G 5: 3,344,211 probably benign Het
Cdx1 TGCTGC TGCTGCCGCTGC 18: 61,019,874 probably benign Het
Cdx1 GCTGCT GCTGCTTCTGCT 18: 61,019,878 probably benign Het
Cfap46 CCTTCT CCTTCTTCT 7: 139,638,930 probably benign Homo
Chd4 GC GCTCCCCC 6: 125,122,131 probably benign Homo
Cluh CCCCGAGCC CCCCGAGCCCGAGCC 11: 74,669,514 probably benign Het
Cluh AGCCTG AGCCTGCGCCTG 11: 74,669,519 probably benign Het
Cluh GAGCCT GAGCCTAAGCCT 11: 74,669,524 probably benign Het
Cluh CC CCTGAGGC 11: 74,669,533 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,569 probably benign Het
Cntnap1 GCCCCA GCCCCAACCCCA 11: 101,189,576 probably benign Het
Cntnap1 GCCCCA GCCCCACCCCCA 11: 101,189,582 probably benign Het
Cntnap1 CCCAGC CCCAGCGCCAGC 11: 101,189,590 probably benign Het
Cul9 CTCTTC CTCTTCTTC 17: 46,500,846 probably benign Het
Cul9 CTC CTCTTC 17: 46,500,858 probably benign Het
Cyth2 C A 7: 45,813,042 S102I possibly damaging Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,686 probably benign Het
Dbr1 GGAGG GGAGGACGAGG 9: 99,583,699 probably benign Het
Dhx8 GACCGA GACCGATACCGA 11: 101,738,179 probably benign Homo
Dhx8 CGAGAC CGAGACGGAGAC 11: 101,738,182 probably benign Homo
Dhx8 GAGACC GAGACCCAGACC 11: 101,738,189 probably benign Homo
Dnah8 ACTGCCCCT ACT 17: 30,635,465 probably benign Het
Dnah8 CCTCCCG C 17: 30,635,477 probably benign Homo
Dnajb5 AGGTG A 4: 42,957,126 probably null Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Homo
E4f1 CCG CCGACG 17: 24,455,192 probably benign Homo
Eif3a TTA TTATTATA 19: 60,775,289 probably benign Het
Fam81b TTC TTCGTC 13: 76,271,319 probably benign Het
Fbxo22 G A 9: 55,209,382 R56H probably damaging Het
Fcgr1 CTTCT C 3: 96,284,504 probably null Het
Fcgr1 T C 3: 96,287,094 D159G probably benign Homo
Fmn1 CCTCCT CCTCCTACTCCT 2: 113,525,778 probably benign Het
Fmn1 CC CCCCCTGC 2: 113,525,781 probably benign Het
Fmn1 CC CCTCCTTC 2: 113,525,784 probably benign Het
G530012D18Rik GA GACAGAGATA 1: 85,577,178 probably null Het
Gli3 G A 13: 15,644,357 R248H probably damaging Het
Gm16503 G A 4: 147,541,253 G68E unknown Het
Gm19345 GGATGGCAGGTG GG 7: 19,857,602 probably null Het
Gm4340 GCA GCAACA 10: 104,196,077 probably benign Het
Gm4340 AGC AGCTGC 10: 104,196,097 probably benign Het
Gm4340 AG AGCGG 10: 104,196,100 probably benign Het
Gm6309 C T 5: 146,168,183 V307I probably benign Het
Gpatch11 AAGAGG AAGAGGCAGAGG 17: 78,842,171 probably benign Het
Gpatch11 AGGAA AGGAAGCGGAA 17: 78,842,180 probably benign Het
Hoxa10 T A 6: 52,234,186 Q250L possibly damaging Homo
Hrh1 T C 6: 114,481,123 I455T possibly damaging Het
Hspa1b GCGCC GC 17: 34,957,129 probably benign Homo
Iba57 GAAA GAAAAA 11: 59,161,505 probably null Homo
Igf1r TGGAGC TGGAGCTGGAGAGGGAGC 7: 68,226,181 probably benign Het
Il17rd CGG CGGAGG 14: 27,082,680 probably benign Het
Il2 AGGTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTGCTG 3: 37,125,764 probably benign Het
Il2 TGG TGGGGCTTGAAGCGG 3: 37,125,828 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Homo
Klra2 G GAAATCCACAT 6: 131,221,852 probably null Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,366 probably benign Het
Kmt2b CCTCCT CCTCCTTCTCCT 7: 30,586,367 probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,586,370 probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,378 probably benign Het
Krt10 TCCGCC TCCGCCGCC 11: 99,386,197 probably benign Homo
Krt10 TCCTCC TCCTCCGCCTCC 11: 99,389,273 probably benign Het
Krt10 TCC TCCTCCACC 11: 99,389,279 probably benign Homo
Krtap28-10 TCCCACA TCCCACACCCACA 1: 83,042,123 probably benign Homo
Krtap4-2 A ACAC 11: 99,635,013 probably benign Het
Krtap9-3 AC ACAGGTGTCGC 11: 99,598,004 probably benign Het
Las1l AGG AGGGGG X: 95,940,821 probably benign Het
Las1l AGG AGGCGG X: 95,940,827 probably benign Het
Las1l GAG GAGCAG X: 95,940,829 probably benign Het
Lrit3 TGC TGCAGC 3: 129,788,806 probably benign Het
Lrit3 GCT GCTTCT 3: 129,788,810 probably benign Het
Lrit3 AC ACATTC 3: 129,803,913 probably null Homo
Luzp1 A AGGTGGCCTCTTCAGT 4: 136,543,196 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,835 probably benign Het
Mamld1 GCA GCAACA X: 71,118,839 probably benign Het
Mapk8ip3 G A 17: 24,902,119 probably null Homo
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,573 probably benign Het
Nat8f2 T A 6: 85,867,686 L231F possibly damaging Homo
Nfxl1 CC CCGGGGAC 5: 72,559,121 probably benign Het
Noc2l GCT GCTTCT 4: 156,240,094 probably benign Het
Noc2l CTG CTGTTG 4: 156,240,095 probably benign Het
Noc2l GGTAG GG 4: 156,241,501 probably benign Homo
Nxpe5 C T 5: 138,229,934 probably benign Het
Olfr1038-ps CAG CAGAG 2: 86,122,760 probably null Homo
Olfr418 GGGCTGCTTGTGGCAAT G 1: 173,270,630 probably null Het
Olfr568 CT CTAATTGCCTT 7: 102,877,233 probably benign Homo
Olfr644 G C 7: 104,071,292 probably benign Homo
Olfr890 A G 9: 38,143,188 I13V probably benign Homo
Osmr C CTCA 15: 6,837,706 probably null Homo
Patl2 CTG CTGTTG 2: 122,126,136 probably benign Het
Patl2 GC GCTAC 2: 122,126,144 probably null Het
Patl2 C CTGA 2: 122,126,145 probably benign Het
Pdik1l GTTTTTGTTTT GTTTTTGTTTTTTTTTTGTTTT 4: 134,279,367 probably null Homo
Pdik1l ACCACC ACCACCCCCACC 4: 134,279,506 probably benign Het
Phc1 GCTG GCTGCTTCTG 6: 122,323,598 probably benign Het
Piezo1 G A 8: 122,495,569 R503W probably damaging Homo
Pitrm1 TTTTA T 13: 6,560,596 probably benign Homo
Pkdrej TG TGGGAGCG 15: 85,819,680 probably benign Homo
Pla2g4e AGGG A 2: 120,244,724 probably benign Homo
Plekhs1 AC ACCTCCCCCGAGCC 19: 56,479,863 probably benign Het
Pnmal1 CCTCATGATGCACCTGCTTCAACATC CCTCATGATGCACCTGCTTCAACATCTCATGATGCACCTGCTTCAACATC 7: 16,961,425 probably benign Homo
Pnmal2 TGGA T 7: 16,946,006 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Homo
Prr13 CTC CTCATC 15: 102,462,173 probably benign Het
Prss41 CACA C 17: 23,844,097 probably benign Het
Prtg GTAAC G 9: 72,857,081 probably benign Het
Ptk2b C T 14: 66,173,849 R411Q possibly damaging Homo
Ptms TCT TCTGCT 6: 124,914,457 probably benign Homo
Ptms TTC TTCGTC 6: 124,914,459 probably benign Homo
Ptms C CTTG 6: 124,914,461 probably benign Homo
Ptpn23 G T 9: 110,387,633 P1052T probably benign Homo
Rab3il1 C A 19: 10,033,751 A264E probably damaging Homo
Rbm6 GCTGT G 9: 107,782,755 probably null Homo
Rtbdn TAG TAGGGGCAG 8: 84,956,161 probably benign Het
Rtbdn AGCG AGCGTCCGCG 8: 84,956,168 probably benign Het
Rtbdn CGGC CGGCAGGGGC 8: 84,956,176 probably benign Het
Rtbdn GGC GGCAGCTGC 8: 84,956,177 probably benign Het
Sbp CAAAG CAAAGCTGCTGACAAAAAAG 17: 23,945,382 probably benign Het
Sbp G GCTGACAACAAAGATC 17: 23,945,389 probably benign Het
Setd1a GTGGTAGTG GTGGTAGTGTTGGTAGTG 7: 127,785,312 probably benign Het
Sfswap GCCCACTC GCCCACTCATCCCACTC 5: 129,569,756 probably benign Het
Six3 GGC GGCAGC 17: 85,621,357 probably benign Het
Six3 GCG GCGCCG 17: 85,621,358 probably benign Het
Six3 CGG CGGGGG 17: 85,621,362 probably benign Het
Six3 GGC GGCAGC 17: 85,621,363 probably benign Het
Six3 CGG CGGGGG 17: 85,621,365 probably benign Het
Six3 CGG CGGGGG 17: 85,621,368 probably benign Het
Slc12a1 ACC ACCTTTGGCCACAACTCC 2: 125,154,214 probably benign Homo
Smarca2 CAGCAGCAGCAGCAGCAGCA CAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,630,999 probably benign Homo
Spaca1 TCGCTC TCGCTCGCGCTC 4: 34,049,836 probably benign Het
Spag1 TTC TTCGTC 15: 36,197,733 probably benign Het
Spag17 AGG AGGCGG 3: 100,056,257 probably benign Het
Srebf2 G T 15: 82,185,335 A693S probably damaging Homo
Srpk2 T C 5: 23,545,196 probably null Homo
Sry GTG GTGTTG Y: 2,662,837 probably benign Homo
Sry TGG TGGGGG Y: 2,662,838 probably benign Homo
Sry AACTGCT A Y: 2,663,195 probably benign Het
St5 CACCACACTGGGGCAGCCCACACTGGGGCAG CCCCACACTGGGGCAG 7: 109,556,921 probably benign Het
Stard9 C CTAAGGGACTAGTAGG 2: 120,696,085 probably benign Het
Supt20 GCAGCA GCAGCAACAGCA 3: 54,727,657 probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,658 probably benign Het
Supt20 CAGCAG CAGCAGAAGCAG 3: 54,727,661 probably benign Het
Tcof1 GGGTA G 18: 60,828,650 probably benign Homo
Tdpoz3 A C 3: 93,826,674 N219H probably benign Het
Tesk1 C CCCCG 4: 43,447,004 probably null Homo
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Tob1 GCA GCAACA 11: 94,214,464 probably benign Het
Tob1 A AGCC 11: 94,214,478 probably benign Het
Trav15-2-dv6-2 AG AGAGG 14: 53,649,756 probably benign Homo
Trav15-2-dv6-2 G GAAA 14: 53,649,757 probably benign Homo
Trim63 GAGT G 4: 134,327,725 probably benign Het
Tsen2 G GAGA 6: 115,560,077 probably benign Het
Ttf2 TC TCCCC 3: 100,963,160 probably benign Homo
Tusc1 ACCGCC ACCGCCCCCGCC 4: 93,335,313 probably benign Homo
Ubqlnl TGAG T 7: 104,149,835 probably benign Homo
Ubtf CCT CCTACT 11: 102,306,948 probably null Het
Ubtf TCC TCCACC 11: 102,306,950 probably benign Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Homo
Wasf3 G T 5: 146,470,250 R460L probably damaging Het
Zc3h13 ATGTGCGAG ATGTGCGAGGTGTGCGAG 14: 75,323,596 probably benign Homo
Zc3h13 TGCGAGATG TGCGAGATGAGCGAGATG 14: 75,323,599 probably benign Homo
Zfhx3 GCAACA GCAACAACAACAACA 8: 108,956,088 probably benign Het
Zfhx3 AGCA AGCAACAGACGCA 8: 108,956,102 probably benign Het
Zfhx3 GCA GCAACAGCACCA 8: 108,956,103 probably benign Het
Zfp111 TCA TCAACA 7: 24,199,805 probably benign Homo
Zfp112 CATGA CATGATGA 7: 24,125,407 probably benign Homo
Zfp26 C A 9: 20,438,546 A241S probably benign Homo
Zfp282 CGG CGGGGG 6: 47,904,790 probably benign Het
Zfp282 CGG CGGGGG 6: 47,904,799 probably benign Het
Zfp335 CTC CTCGTC 2: 164,907,474 probably benign Het
Zfp335 TCC TCCGCC 2: 164,907,475 probably benign Het
Zfp335 TC TCCCC 2: 164,907,484 probably benign Het
Zfp462 CCACC CCACCTCAGCCACAGTCACC 4: 55,009,758 probably benign Het
Zfp462 ACC ACCTCAGCCACAGTCGCC 4: 55,009,760 probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,776 probably benign Het
Zfp598 ACCACC ACCACCGCCACC 17: 24,680,782 probably benign Het
Zfp598 AC ACCACCGC 17: 24,680,791 probably benign Het
Zfp831 TCC TCCCCC 2: 174,645,471 probably benign Het
Zfp831 CTC CTCATC 2: 174,645,476 probably benign Het
Zfp831 TC TCCGC 2: 174,645,483 probably benign Het
Zfp93 CAGGCATAG CAG 7: 24,275,389 probably benign Homo
Zscan10 TGACG TG 17: 23,609,445 probably benign Homo
Other mutations in Cacna1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Cacna1a APN 8 84571208 nonsense probably null
IGL00513:Cacna1a APN 8 84553056 missense probably damaging 1.00
IGL00569:Cacna1a APN 8 84462714 missense probably damaging 1.00
IGL00981:Cacna1a APN 8 84548553 missense probably damaging 1.00
IGL01122:Cacna1a APN 8 84614793 critical splice donor site probably null
IGL01309:Cacna1a APN 8 84523028 missense probably damaging 1.00
IGL01380:Cacna1a APN 8 84559117 missense probably damaging 1.00
IGL01638:Cacna1a APN 8 84571827 missense probably damaging 0.98
IGL01682:Cacna1a APN 8 84536438 missense possibly damaging 0.71
IGL02751:Cacna1a APN 8 84569952 missense probably damaging 1.00
IGL02904:Cacna1a APN 8 84579520 missense probably damaging 1.00
IGL03122:Cacna1a APN 8 84462676 splice site probably benign
totter UTSW 8 84588753 missense probably damaging 0.99
totter2 UTSW 8 84588753 missense probably damaging 0.99
FR4340:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638714 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4548:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638726 small insertion probably benign
IGL03134:Cacna1a UTSW 8 84559087 missense probably damaging 1.00
R0055:Cacna1a UTSW 8 84580058 splice site probably benign
R0118:Cacna1a UTSW 8 84536083 missense probably damaging 1.00
R0284:Cacna1a UTSW 8 84612285 missense probably damaging 1.00
R0581:Cacna1a UTSW 8 84601936 missense possibly damaging 0.83
R0607:Cacna1a UTSW 8 84629831 missense probably damaging 1.00
R1168:Cacna1a UTSW 8 84579501 missense probably damaging 1.00
R1183:Cacna1a UTSW 8 84580217 missense probably damaging 1.00
R1470:Cacna1a UTSW 8 84514950 splice site probably benign
R1503:Cacna1a UTSW 8 84601946 missense probably benign 0.23
R1522:Cacna1a UTSW 8 84633433 missense probably benign 0.00
R1835:Cacna1a UTSW 8 84581357 splice site probably null
R1862:Cacna1a UTSW 8 84415930 missense possibly damaging 0.80
R2148:Cacna1a UTSW 8 84629675 missense possibly damaging 0.71
R2237:Cacna1a UTSW 8 84633765 critical splice donor site probably null
R2567:Cacna1a UTSW 8 84549725 missense probably damaging 1.00
R2999:Cacna1a UTSW 8 84567742 missense probably damaging 1.00
R3025:Cacna1a UTSW 8 84580225 critical splice donor site probably null
R3610:Cacna1a UTSW 8 84559065 missense probably damaging 1.00
R3702:Cacna1a UTSW 8 84617846 missense probably damaging 0.98
R3763:Cacna1a UTSW 8 84583642 missense possibly damaging 0.85
R4025:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4026:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4106:Cacna1a UTSW 8 84583695 missense possibly damaging 0.85
R4296:Cacna1a UTSW 8 84559293 missense probably damaging 1.00
R4664:Cacna1a UTSW 8 84601767 nonsense probably null
R4713:Cacna1a UTSW 8 84549514 missense probably damaging 1.00
R5223:Cacna1a UTSW 8 84587195 missense possibly damaging 0.94
R5408:Cacna1a UTSW 8 84549707 missense probably damaging 1.00
R5644:Cacna1a UTSW 8 84462777 missense probably damaging 1.00
R5734:Cacna1a UTSW 8 84583731 missense probably damaging 0.96
R5786:Cacna1a UTSW 8 84415721 unclassified probably benign
R5833:Cacna1a UTSW 8 84518697 missense probably damaging 1.00
R5886:Cacna1a UTSW 8 84523022 missense probably damaging 0.99
R6049:Cacna1a UTSW 8 84638846 missense probably damaging 0.96
R6054:Cacna1a UTSW 8 84556785 missense probably damaging 0.99
R6117:Cacna1a UTSW 8 84614721 missense probably damaging 1.00
R6149:Cacna1a UTSW 8 84569952 missense probably damaging 1.00
R6195:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6233:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6607:Cacna1a UTSW 8 84579492 missense probably damaging 1.00
R6753:Cacna1a UTSW 8 84580205 missense probably damaging 1.00
R6798:Cacna1a UTSW 8 84611602 missense probably damaging 1.00
R6831:Cacna1a UTSW 8 84571231 missense probably damaging 1.00
R6980:Cacna1a UTSW 8 84612285 missense possibly damaging 0.85
R7051:Cacna1a UTSW 8 84629915 missense possibly damaging 0.85
X0022:Cacna1a UTSW 8 84633699 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TTCAGATGATGCCACGAGGG -3'
(R):5'- TTCCGAAGTCACTCACAGGC -3'

Sequencing Primer
(F):5'- GAAACCAGGGGCTGCTG -3'
(R):5'- AAGTCACTCACAGGCGTCCG -3'
Posted On2018-04-05