Incidental Mutation 'FR4976:Spag17'
Institutional Source Beutler Lab
Gene Symbol Spag17
Ensembl Gene ENSMUSG00000027867
Gene Namesperm associated antigen 17
Synonyms4931427F14Rik, PF6
Accession Numbers

Genbank: NM_028892; MGI: 1921612

Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock #FR4976 ()
Quality Score190.468
Status Not validated
Chromosomal Location99885406-100143322 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) AGG to AGGTGG at 100056254 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164539]
Predicted Effect probably benign
Transcript: ENSMUST00000164539
SMART Domains Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867

low complexity region 155 170 N/A INTRINSIC
low complexity region 384 400 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
coiled coil region 909 964 N/A INTRINSIC
coiled coil region 1079 1120 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1192 1205 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1223 1238 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1931 1942 N/A INTRINSIC
Pfam:PapD-like 2171 2277 1.2e-15 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 221 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik TTC TTCATC 12: 110,668,447 probably benign Het
1700001K19Rik TTC TTCGTC 12: 110,668,450 probably benign Het
2010300C02Rik T A 1: 37,625,035 E594V probably benign Homo
2010300C02Rik C A 1: 37,625,036 E594* probably null Homo
2010300C02Rik A G 1: 37,625,102 S47P probably damaging Homo
4930402H24Rik TCC TCCCCC 2: 130,770,739 probably benign Het
4930402H24Rik TCC TCCACC 2: 130,770,742 probably benign Het
4930402H24Rik C CTCG 2: 130,770,753 probably benign Het
Abt1 TTCTTGCT TT 13: 23,423,711 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,229 probably benign Het
Akap12 AAA AAACAA 10: 4,353,837 probably benign Het
Alg1 GCTCACTCAC GCTCAC 16: 5,244,561 probably null Homo
Alg9 G GCGA 9: 50,775,431 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Anxa7 C T 14: 20,469,411 G113E probably damaging Homo
Apc CCAATAAAG CCAATAAAGTCAATAAAG 18: 34,281,998 probably benign Het
Apc AATAAAGC AATAAAGCCTATAAAGC 18: 34,282,000 probably benign Het
Apc AAGC AAGCCAATATAGC 18: 34,282,004 probably null Het
Atad3a C A 4: 155,753,939 R207L probably damaging Homo
BC051142 AGC AGCGGC 17: 34,460,058 probably benign Het
BC051142 AGC AGCGGC 17: 34,460,061 probably benign Het
Blm ACCT ACCTCCCT 7: 80,463,767 probably benign Homo
Bmp5 GAGGAGT G 9: 75,776,375 probably benign Homo
Bpifa6 A T 2: 153,986,376 Q134L probably benign Homo
Bpifa6 A T 2: 153,986,398 R141S probably benign Homo
Btnl10 AGA AGAGGA 11: 58,923,929 probably benign Homo
Cacna1a ACC ACCGCC 8: 84,638,717 probably benign Het
Cacna1a ACC ACCTCC 8: 84,638,726 probably benign Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGCGGCTGTGGCTG 19: 47,141,262 probably benign Het
Catsper2 C CTTTTACTTTTTT 2: 121,397,542 probably benign Homo
Catsper2 TGTC TGTCGTC 2: 121,397,779 probably benign Homo
Catsper2 CAT CATTAT 2: 121,397,782 probably benign Het
Catsper2 ATCGTCGTCGTC ATCGTCGTCGTCGTC 2: 121,397,795 probably benign Het
Ccdc170 ACCGCC ACCGCCGCC 10: 4,561,008 probably benign Het
Ccdc170 ACC ACCGCC 10: 4,561,023 probably benign Het
Ccdc170 AC ACCTC 10: 4,561,029 probably benign Het
Ccnk TTCCCAC T 12: 108,202,507 probably benign Het
Cdx1 GGGCTGC GGGCTGCGGCTGC 18: 61,019,867 probably benign Het
Cdx1 GCTGCT GCTGCTTCTGCT 18: 61,019,869 probably benign Het
Cep112 G GCTCT 11: 108,425,352 probably benign Het
Cep89 GACT G 7: 35,409,641 probably benign Het
Cfap46 CCTTCT CCTTCTTCT 7: 139,638,930 probably benign Homo
Chd4 GC GCTCCCTC 6: 125,122,131 probably benign Homo
Cluh GCCTGA GCCTGAACCTGA 11: 74,669,520 probably benign Het
Cnpy3 CCT CCTACT 17: 46,736,747 probably null Het
Cntnap1 A ACCCCCC 11: 101,189,569 probably benign Het
Cntnap1 CCCAGC CCCAGCACCAGC 11: 101,189,572 probably benign Het
Cntnap1 CCAGCC CCAGCCTCAGCC 11: 101,189,585 probably benign Het
Cntnap1 GCCCCA GCCCCACCCCCA 11: 101,189,588 probably benign Het
Col4a3 CGTTTTTTTTTTTTTTTT C 1: 82,718,906 probably null Het
Cpne1 AGA AGAGAGA 2: 156,072,025 probably null Homo
Ctsm AGTG AGTGGGTG 13: 61,537,836 probably null Homo
Cttnbp2 GCTGCT GCTGCTCCTGCT 6: 18,367,461 probably benign Het
Cttnbp2 GCTGCT GCTGCTTCTGCT 6: 18,367,467 probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cul9 TCC TCCGCC 17: 46,500,850 probably benign Het
Cul9 TCC TCCCCC 17: 46,500,853 probably benign Het
Cul9 TCC TCCCCC 17: 46,500,856 probably benign Het
Cybrd1 GAAT G 2: 71,138,511 probably benign Homo
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,689 probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,692 probably benign Het
Dbr1 AGG AGGAGGCGG 9: 99,583,701 probably benign Het
Dbr1 GG GGAGGAAG 9: 99,583,702 probably benign Het
Dcaf8 C T 1: 172,172,856 H194Y probably damaging Homo
Dnajc19 AC ACGC 3: 34,057,994 probably null Het
Dthd1 GAC GACTAC 5: 62,843,024 probably benign Homo
Dusp10 G T 1: 184,037,056 C73F probably damaging Homo
Eif3a A ATTTTT 19: 60,775,291 probably benign Homo
Ermn CTT CTTGTT 2: 58,048,080 probably benign Het
Ermn TC TCTAC 2: 58,048,088 probably benign Het
Fam45a ACTC ACTCCTC 19: 60,814,618 probably benign Homo
Fam45a T TTCA 19: 60,814,622 probably benign Homo
Fbxo38 TGCAGC TGC 18: 62,515,347 probably benign Het
Frem3 CT CTTGT 8: 80,615,241 probably benign Homo
Fsip2 TTTTT TTTTTGTTTT 2: 82,984,362 probably benign Het
Fsip2 TT TTTTTCT 2: 82,984,365 probably benign Het
Gabre AGGCT AGGCTGCGGCT X: 72,270,418 probably benign Homo
Gabre T TGAGGCC X: 72,270,422 probably benign Homo
Gm10800 A AC 2: 98,667,033 probably null Homo
Gm14393 T G 2: 175,061,820 N98T probably benign Het
Gm16503 G A 4: 147,541,253 G68E unknown Het
Gm28040 TG TGGCACCTTTCGAG 1: 133,327,323 probably benign Homo
Gm4340 AGC AGCCGC 10: 104,196,079 probably benign Het
Gm6309 C T 5: 146,168,183 V307I probably benign Het
Gm7534 TG TGCCG 4: 134,202,630 probably benign Homo
Golga5 G A 12: 102,475,660 probably null Homo
Gpatch11 GAAGAG GAAGAGCAAGAG 17: 78,842,170 probably benign Het
Gpatch11 AAGAGG AAGAGGCAGAGG 17: 78,842,171 probably benign Het
Gpatch11 AGAGGA AGAGGATGAGGA 17: 78,842,172 probably benign Het
Gpatch11 GAGGAA GAGGAATAGGAA 17: 78,842,173 probably null Het
Gpatch11 AGGAA AGGAAGTGGAA 17: 78,842,180 probably benign Het
H2-K1 GTTT G 17: 33,997,042 probably benign Homo
Hcn1 GCAGC GCAGCGACAGC 13: 117,975,808 probably benign Homo
Hoxa10 T A 6: 52,234,186 Q250L possibly damaging Homo
Igf1r TGGAGC TGGAGCTGGAGAGGGAGC 7: 68,226,181 probably benign Het
Igf1r C CTGGAGATGGAGA 7: 68,226,186 probably benign Het
Il17rd CGG CGGTGG 14: 27,082,677 probably benign Het
Il2 GG GGGGCTTGAAGTAG 3: 37,125,829 probably benign Het
Ipo9 TCC TCCCCC 1: 135,386,281 probably benign Het
Iqcc T TGTCAGCCTCCTTGTACCC 4: 129,616,676 probably benign Het
Isg20l2 AAG AAGTAG 3: 87,931,715 probably null Het
Kcng4 G T 8: 119,633,519 Y39* probably null Homo
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,360 probably benign Het
Kmt2b CTCCTC CTCCTCGTCCTC 7: 30,586,362 probably benign Het
Kmt2b CCTCCT CCTCCTACTCCT 7: 30,586,364 probably null Het
Kmt2b TCCTCC TCCTCCACCTCC 7: 30,586,366 probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,586,373 probably benign Het
Krtap9-3 AC ACAGGTGCCTC 11: 99,598,004 probably benign Homo
Las1l AGG AGGGGG X: 95,940,827 probably benign Het
Las1l GA GAGAA X: 95,940,832 probably benign Het
Las1l A AGGC X: 95,940,833 probably benign Het
Lce1m TGCCAC TGCCACTGCTGCAGCCAC 3: 93,018,148 probably benign Het
Leo1 GGTACCATGCAG GG 9: 75,450,572 probably benign Het
Lrit3 CATA CATAAATA 3: 129,803,910 probably benign Homo
Lrmp CACATTG CACATTGAGGACATTG 6: 145,173,785 probably benign Homo
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 GCA GCAACA X: 71,118,818 probably benign Het
Mast4 TGG TGGGGGCGG 13: 102,736,312 probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,739,247 probably null Homo
Med12l GCA GCACCA 3: 59,275,977 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,702 probably benign Het
Morf4l2 T C X: 136,733,622 K286E probably benign Het
Msantd4 A T 9: 4,384,937 I221F possibly damaging Homo
Mup21 TT TTTTTATATACT 4: 62,149,350 probably benign Het
Nacad A ACCAGGG 11: 6,599,749 probably benign Het
Nacad TCAGGG TCAGGGACAGGG 11: 6,599,756 probably benign Het
Nacad C CAGGGTA 11: 6,599,763 probably benign Het
Nars CCACTCAC CCAC 18: 64,510,445 probably benign Homo
Ndufc2 C T 7: 97,400,274 P29L probably damaging Het
Nkx2-6 C T 14: 69,175,229 T282M probably damaging Homo
Noc2l AGGC AGGCGGC 4: 156,240,092 probably benign Homo
Noc2l CTG CTGGTG 4: 156,240,098 probably benign Het
Nolc1 CAG CAGAAGCAGAAG 19: 46,081,356 probably benign Het
Nolc1 AGC AGCAGCAGCGGC 19: 46,081,375 probably benign Het
Olfr313 T A 11: 58,817,440 V144D possibly damaging Homo
Olfr418 GGGCTGCTTGTGGCAAT G 1: 173,270,630 probably null Het
Olfr547 A AAACCG 7: 102,535,681 probably null Homo
Olfr585 T TTAC 7: 103,098,309 probably benign Homo
Olfr624 AG AGAGG 7: 103,670,966 probably benign Homo
Patl2 CTG CTGGTG 2: 122,126,139 probably benign Het
Patl2 GCT GCTTCT 2: 122,126,141 probably benign Het
Patl2 GC GCTTC 2: 122,126,144 probably benign Het
Patl2 C CTGA 2: 122,126,145 probably benign Het
Pdik1l ACCACC ACCACCCCCACC 4: 134,279,506 probably benign Homo
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Phf3 ACTGCCGCTCCCGCTCC AC 1: 30,805,023 probably benign Het
Pick1 TTC TTCTC 15: 79,255,946 probably null Homo
Piezo1 G A 8: 122,495,569 R503W probably damaging Homo
Pik3ap1 AG AGGGG 19: 41,281,945 probably benign Homo
Pik3c2g AGAGG AGAGGGAGG 6: 139,635,654 probably null Homo
Pitrm1 TTTTA T 13: 6,560,596 probably benign Homo
Pogz GTAAT G 3: 94,874,695 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Homo
Ppp2r5c G T 12: 110,540,738 probably null Homo
Prag1 CCGC CCGCCGC 8: 36,103,883 probably benign Homo
Prr13 CACT CACTACT 15: 102,462,171 probably benign Homo
Prr13 CTC CTCTTC 15: 102,462,176 probably benign Homo
Ptms TCT TCTCCT 6: 124,914,454 probably benign Homo
Ptpn23 G T 9: 110,387,633 P1052T probably benign Homo
Raph1 GG GGGGG 1: 60,489,267 probably benign Homo
Rpa1 TGCTGCC T 11: 75,318,519 probably benign Het
Rpgrip1 GGA GGATGA 14: 52,149,394 probably benign Het
Rpgrip1 GGAAGAAGA GGA 14: 52,149,544 probably benign Het
Rps19 AGCGG AG 7: 24,888,996 probably benign Homo
Rsf1 G GACC 7: 97,579,909 probably benign Homo
Serpina3m A G 12: 104,358,623 probably null Homo
Setd1a TGGTGGTGGT TGGTGGTGGTGGTGGTGGT 7: 127,785,307 probably benign Homo
Setd1a TAGTGGTGG TAGTGGTGGGAGTGGTGG 7: 127,785,316 probably benign Het
Sfswap ACTCAGCCC ACTCAGCCCCCTCAGCCC 5: 129,569,751 probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,423,055 probably benign Het
Sh3pxd2b GCCTGT GCCTGTGCCTGT 11: 32,423,060 probably benign Homo
Shroom4 GCAGCAACA GCA X: 6,624,074 probably benign Het
Six3 GCG GCGTCG 17: 85,621,358 probably benign Het
Six3 CG CGGGG 17: 85,621,371 probably benign Het
Skint8 C T 4: 111,938,902 L258F probably benign Homo
Smoc2 AGTT A 17: 14,401,562 probably benign Homo
Smpx CCCCCA C X: 157,720,924 probably benign Homo
Snx1 TC TCTGC 9: 66,104,929 probably benign Homo
Snx1 C CTTT 9: 66,104,930 probably benign Homo
Sp110 CT CTAAT 1: 85,587,489 probably benign Het
Spaca1 GCTCTC GCTCTCCCTCTC 4: 34,049,844 probably benign Het
Spaca1 CGCTCT CGCTCTTGCTCT 4: 34,049,849 probably benign Het
Srebf2 G T 15: 82,185,335 A693S probably damaging Homo
Sry T TGGG Y: 2,662,841 probably benign Homo
Stard8 AGG AGGTGG X: 99,066,513 probably benign Het
Stard8 AGG AGGTGG X: 99,066,525 probably benign Het
Stk10 CCCA C 11: 32,614,520 probably benign Homo
Tap2 ACTG ACTGCTG 17: 34,205,699 probably benign Homo
Tbc1d5 G C 17: 50,799,931 H532Q probably benign Homo
Tbc1d5 C G 17: 50,799,943 Q528H probably benign Homo
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tmcc1 G A 6: 116,193,380 probably benign Homo
Tob1 AGC AGCCGC 11: 94,214,472 probably benign Het
Tpsab1 TTGCACCTCCT TT 17: 25,343,782 probably benign Het
Trav15-2-dv6-2 GAA GAATAA 14: 53,649,754 probably null Het
Trav15-2-dv6-2 G GAAC 14: 53,649,757 probably benign Homo
Trim16 GTGA GTGATGA 11: 62,820,689 probably benign Homo
Tsen2 AGG AGGCGG 6: 115,560,066 probably benign Homo
Ubtf TC TCCGC 11: 102,306,959 probably benign Het
Vmn1r124 G T 7: 21,259,936 Q228K possibly damaging Het
Vmn1r71 A C 7: 10,748,121 S147R probably benign Homo
Vmn2r99 G A 17: 19,394,285 G756R probably damaging Homo
Vps13b G T 15: 35,846,957 A2629S probably damaging Homo
Wdr75 AAATAA AAA 1: 45,823,404 probably benign Homo
Zfp111 T G 7: 24,199,037 K383T probably damaging Homo
Zfp111 A ATCG 7: 24,199,807 probably benign Homo
Zfp26 C A 9: 20,438,546 A241S probably benign Homo
Zfp282 CGG CGGTGG 6: 47,904,790 probably benign Het
Zfp335 CTC CTCTTC 2: 164,907,474 probably benign Het
Zfp335 TCC TCCACC 2: 164,907,478 probably benign Het
Zfp459 TGA TGAGAGA 13: 67,408,274 probably null Homo
Zfp459 GA GAGTTA 13: 67,408,275 probably null Homo
Zfp459 A AGTGG 13: 67,408,276 probably null Homo
Zfp462 ACC ACCTCAGCCACAGCCGCC 4: 55,009,760 probably benign Het
Zfp462 CC CCTCAGCCACAGCCATC 4: 55,009,761 probably benign Het
Zfp598 CCACAGGC CC 17: 24,679,372 probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,782 probably benign Het
Zfp683 AG AGGGG 4: 134,058,879 probably benign Homo
Other mutations in Spag17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Spag17 APN 3 100063375 missense probably benign 0.00
IGL01143:Spag17 APN 3 99939298 missense probably benign 0.00
IGL01329:Spag17 APN 3 100095549 missense probably benign 0.16
IGL01393:Spag17 APN 3 100027610 missense possibly damaging 0.53
IGL01617:Spag17 APN 3 100109508 missense possibly damaging 0.65
IGL01705:Spag17 APN 3 100022730 missense probably benign 0.01
IGL01928:Spag17 APN 3 99940074 splice site probably benign
IGL01981:Spag17 APN 3 100058833 missense probably benign 0.03
IGL02435:Spag17 APN 3 99982444 missense possibly damaging 0.53
IGL02452:Spag17 APN 3 100027391 missense probably benign 0.00
IGL02465:Spag17 APN 3 100075871 missense probably damaging 0.96
IGL02615:Spag17 APN 3 100072085 missense probably benign 0.09
IGL02751:Spag17 APN 3 100010794 nonsense probably null
IGL02803:Spag17 APN 3 100109397 missense probably benign
IGL02898:Spag17 APN 3 100101386 missense probably benign 0.00
IGL03037:Spag17 APN 3 100072170 splice site probably null
IGL03068:Spag17 APN 3 100080205 missense probably benign 0.35
IGL03131:Spag17 APN 3 100010759 missense possibly damaging 0.85
IGL03224:Spag17 APN 3 100010840 missense possibly damaging 0.53
FR4342:Spag17 UTSW 3 100056249 small insertion probably benign
FR4342:Spag17 UTSW 3 100056252 small insertion probably benign
FR4548:Spag17 UTSW 3 100056254 small insertion probably benign
FR4589:Spag17 UTSW 3 100056245 small insertion probably benign
FR4589:Spag17 UTSW 3 100056258 small insertion probably benign
FR4737:Spag17 UTSW 3 100056257 small insertion probably benign
FR4976:Spag17 UTSW 3 100056255 small insertion probably benign
N/A:Spag17 UTSW 3 99982254 splice site probably benign
R0107:Spag17 UTSW 3 100050787 missense possibly damaging 0.72
R0230:Spag17 UTSW 3 100106827 missense probably benign 0.08
R0243:Spag17 UTSW 3 100085368 missense probably benign 0.04
R0321:Spag17 UTSW 3 100101403 missense probably damaging 0.99
R0375:Spag17 UTSW 3 100027590 missense probably benign
R0417:Spag17 UTSW 3 100065554 missense probably benign 0.11
R0490:Spag17 UTSW 3 99982411 missense probably damaging 0.97
R0537:Spag17 UTSW 3 100125302 missense probably damaging 0.98
R0714:Spag17 UTSW 3 100080156 missense probably damaging 0.97
R0844:Spag17 UTSW 3 100004785 missense probably benign
R0919:Spag17 UTSW 3 100071943 splice site probably benign
R0926:Spag17 UTSW 3 100072116 missense probably benign
R1037:Spag17 UTSW 3 100103117 missense probably benign 0.01
R1075:Spag17 UTSW 3 100093676 missense probably damaging 0.99
R1109:Spag17 UTSW 3 100027351 missense possibly damaging 0.86
R1213:Spag17 UTSW 3 100095638 missense probably benign 0.01
R1221:Spag17 UTSW 3 99982268 missense possibly damaging 0.72
R1576:Spag17 UTSW 3 99939363 missense possibly damaging 0.73
R1586:Spag17 UTSW 3 100021752 missense possibly damaging 0.53
R1768:Spag17 UTSW 3 100027352 missense possibly damaging 0.53
R1782:Spag17 UTSW 3 100010754 missense probably benign 0.02
R1789:Spag17 UTSW 3 99939356 missense possibly damaging 0.73
R1945:Spag17 UTSW 3 99939982 missense probably benign
R2065:Spag17 UTSW 3 100013208 missense probably benign 0.03
R2118:Spag17 UTSW 3 100049240 missense possibly damaging 0.72
R2265:Spag17 UTSW 3 100061866 splice site probably null
R2266:Spag17 UTSW 3 100061866 splice site probably null
R2267:Spag17 UTSW 3 100061866 splice site probably null
R2268:Spag17 UTSW 3 100061866 splice site probably null
R2271:Spag17 UTSW 3 100106797 missense probably damaging 1.00
R2389:Spag17 UTSW 3 100106837 missense probably benign 0.27
R2420:Spag17 UTSW 3 100027619 missense probably benign
R2422:Spag17 UTSW 3 100027619 missense probably benign
R2423:Spag17 UTSW 3 100103456 missense probably benign
R3407:Spag17 UTSW 3 100085299 missense probably benign 0.09
R3801:Spag17 UTSW 3 100053853 missense possibly damaging 0.53
R3856:Spag17 UTSW 3 100106759 missense probably damaging 1.00
R4021:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4022:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4408:Spag17 UTSW 3 100103378 missense probably benign
R4468:Spag17 UTSW 3 100085366 missense probably damaging 0.98
R4540:Spag17 UTSW 3 100088381 missense probably damaging 1.00
R4621:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4622:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4756:Spag17 UTSW 3 100103385 missense possibly damaging 0.68
R4797:Spag17 UTSW 3 99984479 missense possibly damaging 0.70
R4855:Spag17 UTSW 3 100063333 missense probably benign 0.02
R4887:Spag17 UTSW 3 100050831 missense probably damaging 1.00
R4962:Spag17 UTSW 3 100027623 missense probably benign
R5030:Spag17 UTSW 3 100085341 nonsense probably null
R5042:Spag17 UTSW 3 100072149 missense probably damaging 1.00
R5074:Spag17 UTSW 3 100080118 missense possibly damaging 0.94
R5195:Spag17 UTSW 3 100101388 missense probably benign 0.16
R5200:Spag17 UTSW 3 100063471 nonsense probably null
R5267:Spag17 UTSW 3 100061948 missense probably damaging 0.98
R5360:Spag17 UTSW 3 100109410 missense probably benign 0.00
R5444:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5498:Spag17 UTSW 3 100103345 missense possibly damaging 0.83
R5503:Spag17 UTSW 3 100027244 missense possibly damaging 0.72
R5540:Spag17 UTSW 3 100056272 missense possibly damaging 0.91
R5547:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5575:Spag17 UTSW 3 100053822 missense possibly damaging 0.85
R5629:Spag17 UTSW 3 100080119 missense probably benign 0.33
R5639:Spag17 UTSW 3 100056166 missense probably damaging 1.00
R5842:Spag17 UTSW 3 99939250 missense possibly damaging 0.85
R5976:Spag17 UTSW 3 100095791 nonsense probably null
R6082:Spag17 UTSW 3 100124185 missense possibly damaging 0.46
R6228:Spag17 UTSW 3 100022602 missense probably benign 0.33
R6254:Spag17 UTSW 3 100065585 missense probably benign 0.03
R6321:Spag17 UTSW 3 100088427 missense probably benign 0.05
R6446:Spag17 UTSW 3 100103132 missense probably benign
R6687:Spag17 UTSW 3 100092950 missense probably benign 0.07
R6853:Spag17 UTSW 3 100013235 missense possibly damaging 0.86
R6946:Spag17 UTSW 3 100004683 missense possibly damaging 0.53
R6953:Spag17 UTSW 3 100034975 missense possibly damaging 0.53
X0025:Spag17 UTSW 3 100101451 missense probably benign 0.31
Z1088:Spag17 UTSW 3 100095630 missense probably benign 0.09
Predicted Primers PCR Primer

Sequencing Primer
Posted On2018-04-05