Incidental Mutation 'FR4976:Chd4'
ID511852
Institutional Source Beutler Lab
Gene Symbol Chd4
Ensembl Gene ENSMUSG00000063870
Gene Namechromodomain helicase DNA binding protein 4
SynonymsD6Ertd380e, Mi-2beta, 9530019N15Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.982) question?
Stock #FR4976 ()
Quality Score214.458
Status Not validated
Chromosome6
Chromosomal Location125095981-125130591 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GC to GCTCCCTC at 125122131 bp
ZygosityHomozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056889] [ENSMUST00000112390] [ENSMUST00000112392] [ENSMUST00000124317]
Predicted Effect probably benign
Transcript: ENSMUST00000056889
SMART Domains Protein: ENSMUSP00000060054
Gene: ENSMUSG00000063870

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
low complexity region 107 144 N/A INTRINSIC
Pfam:CHDNT 156 210 7.7e-35 PFAM
low complexity region 217 249 N/A INTRINSIC
low complexity region 271 291 N/A INTRINSIC
low complexity region 296 318 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
PHD 365 408 7.17e-15 SMART
RING 366 407 7.46e-1 SMART
low complexity region 424 443 N/A INTRINSIC
PHD 444 487 4.41e-15 SMART
RING 445 486 2.63e0 SMART
CHROMO 492 572 8.11e-17 SMART
CHROMO 613 670 1.98e-11 SMART
low complexity region 675 694 N/A INTRINSIC
DEXDc 715 927 2.73e-37 SMART
low complexity region 1044 1056 N/A INTRINSIC
HELICc 1073 1157 7.61e-27 SMART
DUF1087 1282 1346 5.56e-33 SMART
DUF1086 1359 1516 4.05e-108 SMART
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1590 1633 N/A INTRINSIC
low complexity region 1635 1653 N/A INTRINSIC
low complexity region 1661 1674 N/A INTRINSIC
Pfam:CHDCT2 1727 1899 1.9e-98 PFAM
low complexity region 1903 1915 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112390
SMART Domains Protein: ENSMUSP00000108009
Gene: ENSMUSG00000063870

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 114 151 N/A INTRINSIC
Pfam:CHDNT 164 217 2e-28 PFAM
low complexity region 224 256 N/A INTRINSIC
low complexity region 278 298 N/A INTRINSIC
low complexity region 303 325 N/A INTRINSIC
low complexity region 328 354 N/A INTRINSIC
PHD 372 415 7.17e-15 SMART
RING 373 414 7.46e-1 SMART
low complexity region 431 450 N/A INTRINSIC
PHD 451 494 4.41e-15 SMART
RING 452 493 2.63e0 SMART
CHROMO 499 579 8.11e-17 SMART
CHROMO 620 677 1.98e-11 SMART
low complexity region 682 701 N/A INTRINSIC
DEXDc 722 934 2.73e-37 SMART
low complexity region 1051 1063 N/A INTRINSIC
HELICc 1080 1164 7.61e-27 SMART
DUF1087 1289 1353 5.56e-33 SMART
DUF1086 1366 1523 4.05e-108 SMART
low complexity region 1533 1547 N/A INTRINSIC
low complexity region 1567 1585 N/A INTRINSIC
low complexity region 1597 1640 N/A INTRINSIC
low complexity region 1642 1660 N/A INTRINSIC
low complexity region 1668 1681 N/A INTRINSIC
Pfam:CHDCT2 1735 1906 4.3e-90 PFAM
low complexity region 1910 1922 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112392
SMART Domains Protein: ENSMUSP00000108011
Gene: ENSMUSG00000063870

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
low complexity region 107 144 N/A INTRINSIC
Pfam:CHDNT 156 210 1.1e-34 PFAM
low complexity region 217 249 N/A INTRINSIC
low complexity region 271 291 N/A INTRINSIC
low complexity region 296 318 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
PHD 352 395 7.17e-15 SMART
RING 353 394 7.46e-1 SMART
low complexity region 411 430 N/A INTRINSIC
PHD 431 474 4.41e-15 SMART
RING 432 473 2.63e0 SMART
CHROMO 479 559 8.11e-17 SMART
CHROMO 600 657 1.98e-11 SMART
low complexity region 662 681 N/A INTRINSIC
DEXDc 702 914 2.73e-37 SMART
low complexity region 1031 1043 N/A INTRINSIC
HELICc 1060 1144 7.61e-27 SMART
DUF1087 1269 1333 5.56e-33 SMART
DUF1086 1346 1503 4.05e-108 SMART
low complexity region 1513 1527 N/A INTRINSIC
low complexity region 1547 1565 N/A INTRINSIC
low complexity region 1577 1620 N/A INTRINSIC
low complexity region 1622 1640 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
Pfam:CHDCT2 1714 1886 2.8e-98 PFAM
low complexity region 1890 1902 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124317
SMART Domains Protein: ENSMUSP00000120704
Gene: ENSMUSG00000063870

DomainStartEndE-ValueType
PDB:3MWY|W 1 137 2e-13 PDB
DUF1087 141 205 5.56e-33 SMART
low complexity region 209 221 N/A INTRINSIC
DUF1086 246 403 4.05e-108 SMART
low complexity region 413 427 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157583
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the SNF2/RAD54 helicase family. It represents the main component of the nucleosome remodeling and deacetylase complex and plays an important role in epigenetic transcriptional repression. Patients with dermatomyositis develop antibodies against this protein. Somatic mutations in this gene are associated with serous endometrial tumors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality between E3.5 and E4.5, absent blastocoele failure of trophectoderm function and increased apoptosis in blastocysts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 222 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik TTC TTCATC 12: 110,668,447 probably benign Het
1700001K19Rik TTC TTCGTC 12: 110,668,450 probably benign Het
2010300C02Rik T A 1: 37,625,035 E594V probably benign Homo
2010300C02Rik C A 1: 37,625,036 E594* probably null Homo
2010300C02Rik A G 1: 37,625,102 S47P probably damaging Homo
4930402H24Rik TCC TCCCCC 2: 130,770,739 probably benign Het
4930402H24Rik TCC TCCACC 2: 130,770,742 probably benign Het
4930402H24Rik C CTCG 2: 130,770,753 probably benign Het
Abt1 TTCTTGCT TT 13: 23,423,711 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,229 probably benign Het
Akap12 AAA AAACAA 10: 4,353,837 probably benign Het
Alg1 GCTCACTCAC GCTCAC 16: 5,244,561 probably null Homo
Alg9 G GCGA 9: 50,775,431 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Anapc2 TGGCGGTGGCGGCGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGG 2: 25,272,532 probably benign Het
Anxa7 C T 14: 20,469,411 G113E probably damaging Homo
Apc CCAATAAAG CCAATAAAGTCAATAAAG 18: 34,281,998 probably benign Het
Apc AATAAAGC AATAAAGCCTATAAAGC 18: 34,282,000 probably benign Het
Apc AAGC AAGCCAATATAGC 18: 34,282,004 probably null Het
Atad3a C A 4: 155,753,939 R207L probably damaging Homo
BC051142 AGC AGCGGC 17: 34,460,058 probably benign Het
BC051142 AGC AGCGGC 17: 34,460,061 probably benign Het
Blm ACCT ACCTCCCT 7: 80,463,767 probably benign Homo
Blm TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,907 probably benign Het
Bmp5 GAGGAGT G 9: 75,776,375 probably benign Homo
Bpifa6 A T 2: 153,986,376 Q134L probably benign Homo
Bpifa6 A T 2: 153,986,398 R141S probably benign Homo
Btnl10 AGA AGAGGA 11: 58,923,929 probably benign Homo
Cacna1a ACC ACCGCC 8: 84,638,717 probably benign Het
Cacna1a ACC ACCTCC 8: 84,638,726 probably benign Het
Calhm1 TGGCTGTGGCTG TGGCTGTGGCTGCGGCTGTGGCTG 19: 47,141,262 probably benign Het
Catsper2 C CTTTTACTTTTTT 2: 121,397,542 probably benign Homo
Catsper2 TGTC TGTCGTC 2: 121,397,779 probably benign Homo
Catsper2 CAT CATTAT 2: 121,397,782 probably benign Het
Catsper2 ATCGTCGTCGTC ATCGTCGTCGTCGTC 2: 121,397,795 probably benign Het
Ccdc170 ACCGCC ACCGCCGCC 10: 4,561,008 probably benign Het
Ccdc170 ACC ACCGCC 10: 4,561,023 probably benign Het
Ccdc170 AC ACCTC 10: 4,561,029 probably benign Het
Ccnk TTCCCAC T 12: 108,202,507 probably benign Het
Cdx1 GGGCTGC GGGCTGCGGCTGC 18: 61,019,867 probably benign Het
Cdx1 GCTGCT GCTGCTTCTGCT 18: 61,019,869 probably benign Het
Cep112 G GCTCT 11: 108,425,352 probably benign Het
Cep89 GACT G 7: 35,409,641 probably benign Het
Cfap46 CCTTCT CCTTCTTCT 7: 139,638,930 probably benign Homo
Cluh GCCTGA GCCTGAACCTGA 11: 74,669,520 probably benign Het
Cnpy3 CCT CCTACT 17: 46,736,747 probably null Het
Cntnap1 A ACCCCCC 11: 101,189,569 probably benign Het
Cntnap1 CCCAGC CCCAGCACCAGC 11: 101,189,572 probably benign Het
Cntnap1 CCAGCC CCAGCCTCAGCC 11: 101,189,585 probably benign Het
Cntnap1 GCCCCA GCCCCACCCCCA 11: 101,189,588 probably benign Het
Col4a3 CGTTTTTTTTTTTTTTTT C 1: 82,718,906 probably null Het
Cpne1 AGA AGAGAGA 2: 156,072,025 probably null Homo
Ctsm AGTG AGTGGGTG 13: 61,537,836 probably null Homo
Cttnbp2 GCTGCT GCTGCTCCTGCT 6: 18,367,461 probably benign Het
Cttnbp2 GCTGCT GCTGCTTCTGCT 6: 18,367,467 probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cul9 TCC TCCGCC 17: 46,500,850 probably benign Het
Cul9 TCC TCCCCC 17: 46,500,853 probably benign Het
Cul9 TCC TCCCCC 17: 46,500,856 probably benign Het
Cybrd1 GAAT G 2: 71,138,511 probably benign Homo
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,689 probably benign Het
Dbr1 AGGAGG AGGAGGCGGAGG 9: 99,583,692 probably benign Het
Dbr1 AGG AGGAGGCGG 9: 99,583,701 probably benign Het
Dbr1 GG GGAGGAAG 9: 99,583,702 probably benign Het
Dcaf8 C T 1: 172,172,856 H194Y probably damaging Homo
Dnajc19 AC ACGC 3: 34,057,994 probably null Het
Dthd1 GAC GACTAC 5: 62,843,024 probably benign Homo
Dusp10 G T 1: 184,037,056 C73F probably damaging Homo
Eif3a A ATTTTT 19: 60,775,291 probably benign Homo
Ermn CTT CTTGTT 2: 58,048,080 probably benign Het
Ermn TC TCTAC 2: 58,048,088 probably benign Het
Fam45a ACTC ACTCCTC 19: 60,814,618 probably benign Homo
Fam45a T TTCA 19: 60,814,622 probably benign Homo
Fbxo38 TGCAGC TGC 18: 62,515,347 probably benign Het
Frem3 CT CTTGT 8: 80,615,241 probably benign Homo
Fsip2 TTTTT TTTTTGTTTT 2: 82,984,362 probably benign Het
Fsip2 TT TTTTTCT 2: 82,984,365 probably benign Het
Gabre AGGCT AGGCTGCGGCT X: 72,270,418 probably benign Homo
Gabre T TGAGGCC X: 72,270,422 probably benign Homo
Gm10800 A AC 2: 98,667,033 probably null Homo
Gm14393 T G 2: 175,061,820 N98T probably benign Het
Gm16503 G A 4: 147,541,253 G68E unknown Het
Gm28040 TG TGGCACCTTTCGAG 1: 133,327,323 probably benign Homo
Gm4340 AGC AGCCGC 10: 104,196,079 probably benign Het
Gm6309 C T 5: 146,168,183 V307I probably benign Het
Gm7534 TG TGCCG 4: 134,202,630 probably benign Homo
Golga5 G A 12: 102,475,660 probably null Homo
Gpatch11 GAAGAG GAAGAGCAAGAG 17: 78,842,170 probably benign Het
Gpatch11 AAGAGG AAGAGGCAGAGG 17: 78,842,171 probably benign Het
Gpatch11 AGAGGA AGAGGATGAGGA 17: 78,842,172 probably benign Het
Gpatch11 GAGGAA GAGGAATAGGAA 17: 78,842,173 probably null Het
Gpatch11 AGGAA AGGAAGTGGAA 17: 78,842,180 probably benign Het
H2-K1 GTTT G 17: 33,997,042 probably benign Homo
Hcn1 GCAGC GCAGCGACAGC 13: 117,975,808 probably benign Homo
Hoxa10 T A 6: 52,234,186 Q250L possibly damaging Homo
Igf1r TGGAGC TGGAGCTGGAGAGGGAGC 7: 68,226,181 probably benign Het
Igf1r C CTGGAGATGGAGA 7: 68,226,186 probably benign Het
Il17rd CGG CGGTGG 14: 27,082,677 probably benign Het
Il2 GG GGGGCTTGAAGTAG 3: 37,125,829 probably benign Het
Ipo9 TCC TCCCCC 1: 135,386,281 probably benign Het
Iqcc T TGTCAGCCTCCTTGTACCC 4: 129,616,676 probably benign Het
Isg20l2 AAG AAGTAG 3: 87,931,715 probably null Het
Kcng4 G T 8: 119,633,519 Y39* probably null Homo
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,360 probably benign Het
Kmt2b CTCCTC CTCCTCGTCCTC 7: 30,586,362 probably benign Het
Kmt2b CCTCCT CCTCCTACTCCT 7: 30,586,364 probably null Het
Kmt2b TCCTCC TCCTCCACCTCC 7: 30,586,366 probably benign Het
Kmt2b CCTCCT CCTCCTGCTCCT 7: 30,586,373 probably benign Het
Kmt2c TGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT TGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 5: 25,315,763 probably benign Homo
Krtap9-3 AC ACAGGTGCCTC 11: 99,598,004 probably benign Homo
Las1l AGG AGGGGG X: 95,940,827 probably benign Het
Las1l GA GAGAA X: 95,940,832 probably benign Het
Las1l A AGGC X: 95,940,833 probably benign Het
Lce1m TGCCAC TGCCACTGCTGCAGCCAC 3: 93,018,148 probably benign Het
Leo1 GGTACCATGCAG GG 9: 75,450,572 probably benign Het
Lrit3 CATA CATAAATA 3: 129,803,910 probably benign Homo
Lrmp CACATTG CACATTGAGGACATTG 6: 145,173,785 probably benign Homo
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 GCA GCAACA X: 71,118,818 probably benign Het
Mast4 TGG TGGGGGCGG 13: 102,736,312 probably benign Het
Mast4 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG 13: 102,739,247 probably null Homo
Med12l GCA GCACCA 3: 59,275,977 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,702 probably benign Het
Morf4l2 T C X: 136,733,622 K286E probably benign Het
Msantd4 A T 9: 4,384,937 I221F possibly damaging Homo
Mup21 TT TTTTTATATACT 4: 62,149,350 probably benign Het
Nacad A ACCAGGG 11: 6,599,749 probably benign Het
Nacad TCAGGG TCAGGGACAGGG 11: 6,599,756 probably benign Het
Nacad C CAGGGTA 11: 6,599,763 probably benign Het
Nars CCACTCAC CCAC 18: 64,510,445 probably benign Homo
Ndufc2 C T 7: 97,400,274 P29L probably damaging Het
Nkx2-6 C T 14: 69,175,229 T282M probably damaging Homo
Noc2l AGGC AGGCGGC 4: 156,240,092 probably benign Homo
Noc2l CTG CTGGTG 4: 156,240,098 probably benign Het
Nolc1 CAG CAGAAGCAGAAG 19: 46,081,356 probably benign Het
Nolc1 AGC AGCAGCAGCGGC 19: 46,081,375 probably benign Het
Olfr313 T A 11: 58,817,440 V144D possibly damaging Homo
Olfr418 GGGCTGCTTGTGGCAAT G 1: 173,270,630 probably null Het
Olfr547 A AAACCG 7: 102,535,681 probably null Homo
Olfr585 T TTAC 7: 103,098,309 probably benign Homo
Olfr624 AG AGAGG 7: 103,670,966 probably benign Homo
Patl2 CTG CTGGTG 2: 122,126,139 probably benign Het
Patl2 GCT GCTTCT 2: 122,126,141 probably benign Het
Patl2 GC GCTTC 2: 122,126,144 probably benign Het
Patl2 C CTGA 2: 122,126,145 probably benign Het
Pdik1l ACCACC ACCACCCCCACC 4: 134,279,506 probably benign Homo
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Phf3 ACTGCCGCTCCCGCTCC AC 1: 30,805,023 probably benign Het
Pick1 TTC TTCTC 15: 79,255,946 probably null Homo
Piezo1 G A 8: 122,495,569 R503W probably damaging Homo
Pik3ap1 AG AGGGG 19: 41,281,945 probably benign Homo
Pik3c2g AGAGG AGAGGGAGG 6: 139,635,654 probably null Homo
Pitrm1 TTTTA T 13: 6,560,596 probably benign Homo
Pogz GTAAT G 3: 94,874,695 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Homo
Ppp2r5c G T 12: 110,540,738 probably null Homo
Prag1 CCGC CCGCCGC 8: 36,103,883 probably benign Homo
Prr13 CACT CACTACT 15: 102,462,171 probably benign Homo
Prr13 CTC CTCTTC 15: 102,462,176 probably benign Homo
Ptms TCT TCTCCT 6: 124,914,454 probably benign Homo
Ptpn23 G T 9: 110,387,633 P1052T probably benign Homo
Raph1 GG GGGGG 1: 60,489,267 probably benign Homo
Rpa1 TGCTGCC T 11: 75,318,519 probably benign Het
Rpgrip1 GGA GGATGA 14: 52,149,394 probably benign Het
Rpgrip1 GGAAGAAGA GGA 14: 52,149,544 probably benign Het
Rps19 AGCGG AG 7: 24,888,996 probably benign Homo
Rsf1 G GACC 7: 97,579,909 probably benign Homo
Serpina3m A G 12: 104,358,623 probably null Homo
Setd1a TGGTGGTGGT TGGTGGTGGTGGTGGTGGT 7: 127,785,307 probably benign Homo
Setd1a TAGTGGTGG TAGTGGTGGGAGTGGTGG 7: 127,785,316 probably benign Het
Sfswap ACTCAGCCC ACTCAGCCCCCTCAGCCC 5: 129,569,751 probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,423,055 probably benign Het
Sh3pxd2b GCCTGT GCCTGTGCCTGT 11: 32,423,060 probably benign Homo
Shroom4 GCAGCAACA GCA X: 6,624,074 probably benign Het
Six3 GCG GCGTCG 17: 85,621,358 probably benign Het
Six3 CG CGGGG 17: 85,621,371 probably benign Het
Skint8 C T 4: 111,938,902 L258F probably benign Homo
Smoc2 AGTT A 17: 14,401,562 probably benign Homo
Smpx CCCCCA C X: 157,720,924 probably benign Homo
Snx1 TC TCTGC 9: 66,104,929 probably benign Homo
Snx1 C CTTT 9: 66,104,930 probably benign Homo
Sp110 CT CTAAT 1: 85,587,489 probably benign Het
Spaca1 GCTCTC GCTCTCCCTCTC 4: 34,049,844 probably benign Het
Spaca1 CGCTCT CGCTCTTGCTCT 4: 34,049,849 probably benign Het
Spag17 AGG AGGTGG 3: 100,056,254 probably benign Het
Spag17 GGA GGACGA 3: 100,056,255 probably benign Het
Srebf2 G T 15: 82,185,335 A693S probably damaging Homo
Sry T TGGG Y: 2,662,841 probably benign Homo
Stard8 AGG AGGTGG X: 99,066,513 probably benign Het
Stard8 AGG AGGTGG X: 99,066,525 probably benign Het
Stk10 CCCA C 11: 32,614,520 probably benign Homo
Tap2 ACTG ACTGCTG 17: 34,205,699 probably benign Homo
Tbc1d5 G C 17: 50,799,931 H532Q probably benign Homo
Tbc1d5 C G 17: 50,799,943 Q528H probably benign Homo
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tmcc1 G A 6: 116,193,380 probably benign Homo
Tob1 AGC AGCCGC 11: 94,214,472 probably benign Het
Tpsab1 TTGCACCTCCT TT 17: 25,343,782 probably benign Het
Trav15-2-dv6-2 GAA GAATAA 14: 53,649,754 probably null Het
Trav15-2-dv6-2 G GAAC 14: 53,649,757 probably benign Homo
Trim16 GTGA GTGATGA 11: 62,820,689 probably benign Homo
Tsen2 AGG AGGCGG 6: 115,560,066 probably benign Homo
Ubtf TC TCCGC 11: 102,306,959 probably benign Het
Vmn1r124 G T 7: 21,259,936 Q228K possibly damaging Het
Vmn1r71 A C 7: 10,748,121 S147R probably benign Homo
Vmn2r99 G A 17: 19,394,285 G756R probably damaging Homo
Vps13b G T 15: 35,846,957 A2629S probably damaging Homo
Wdr75 AAATAA AAA 1: 45,823,404 probably benign Homo
Zfp111 T G 7: 24,199,037 K383T probably damaging Homo
Zfp111 A ATCG 7: 24,199,807 probably benign Homo
Zfp26 C A 9: 20,438,546 A241S probably benign Homo
Zfp282 CGG CGGTGG 6: 47,904,790 probably benign Het
Zfp335 CTC CTCTTC 2: 164,907,474 probably benign Het
Zfp335 TCC TCCACC 2: 164,907,478 probably benign Het
Zfp459 TGA TGAGAGA 13: 67,408,274 probably null Homo
Zfp459 GA GAGTTA 13: 67,408,275 probably null Homo
Zfp459 A AGTGG 13: 67,408,276 probably null Homo
Zfp462 ACC ACCTCAGCCACAGCCGCC 4: 55,009,760 probably benign Het
Zfp462 CC CCTCAGCCACAGCCATC 4: 55,009,761 probably benign Het
Zfp598 CCACAGGC CC 17: 24,679,372 probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,782 probably benign Het
Zfp683 AG AGGGG 4: 134,058,879 probably benign Homo
Other mutations in Chd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Chd4 APN 6 125109897 missense probably damaging 1.00
IGL00917:Chd4 APN 6 125104946 missense possibly damaging 0.95
IGL01088:Chd4 APN 6 125122468 unclassified probably benign
IGL02005:Chd4 APN 6 125128816 missense possibly damaging 0.71
IGL02405:Chd4 APN 6 125097227 missense probably benign 0.06
IGL02707:Chd4 APN 6 125108767 missense probably damaging 1.00
IGL02976:Chd4 APN 6 125121368 missense probably damaging 1.00
IGL03001:Chd4 APN 6 125101566 missense possibly damaging 0.93
FR4304:Chd4 UTSW 6 125122144 unclassified probably benign
FR4589:Chd4 UTSW 6 125122133 missense probably benign 0.02
FR4589:Chd4 UTSW 6 125122139 unclassified probably benign
FR4737:Chd4 UTSW 6 125122131 unclassified probably benign
R0311:Chd4 UTSW 6 125101665 missense probably benign 0.15
R0414:Chd4 UTSW 6 125107480 missense probably damaging 1.00
R0647:Chd4 UTSW 6 125109123 missense probably damaging 1.00
R0656:Chd4 UTSW 6 125102967 missense probably damaging 0.98
R1342:Chd4 UTSW 6 125097188 missense probably benign 0.40
R1651:Chd4 UTSW 6 125123584 missense possibly damaging 0.92
R1850:Chd4 UTSW 6 125121656 missense probably damaging 1.00
R2190:Chd4 UTSW 6 125114297 missense probably benign 0.18
R2192:Chd4 UTSW 6 125105357 missense probably damaging 0.99
R2858:Chd4 UTSW 6 125104886 missense probably damaging 0.99
R3406:Chd4 UTSW 6 125122007 missense probably benign 0.09
R3431:Chd4 UTSW 6 125120560 splice site probably benign
R4330:Chd4 UTSW 6 125101602 missense probably benign 0.29
R4394:Chd4 UTSW 6 125121618 missense probably damaging 0.99
R4538:Chd4 UTSW 6 125120686 missense probably damaging 0.99
R4664:Chd4 UTSW 6 125101502 missense possibly damaging 0.58
R4805:Chd4 UTSW 6 125128945 missense possibly damaging 0.86
R5050:Chd4 UTSW 6 125107480 missense probably damaging 1.00
R5055:Chd4 UTSW 6 125100986 missense possibly damaging 0.65
R5232:Chd4 UTSW 6 125121310 missense probably damaging 1.00
R5314:Chd4 UTSW 6 125100588 missense probably damaging 0.96
R5343:Chd4 UTSW 6 125120363 missense probably damaging 1.00
R5502:Chd4 UTSW 6 125105276 missense possibly damaging 0.83
R5613:Chd4 UTSW 6 125120546 missense probably damaging 0.99
R6211:Chd4 UTSW 6 125101285 missense possibly damaging 0.82
R6606:Chd4 UTSW 6 125109426 missense probably damaging 0.99
R6753:Chd4 UTSW 6 125114300 missense probably benign 0.01
R6808:Chd4 UTSW 6 125122123 missense possibly damaging 0.53
R6939:Chd4 UTSW 6 125106538 missense probably damaging 0.99
R6968:Chd4 UTSW 6 125108318 missense probably damaging 1.00
X0025:Chd4 UTSW 6 125106467 nonsense probably null
X0027:Chd4 UTSW 6 125102164 missense probably damaging 0.98
X0063:Chd4 UTSW 6 125114015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATGACATGGCCTCTGAC -3'
(R):5'- TACAGAGCGGCCTTCAGTTG -3'

Sequencing Primer
(F):5'- ACATGGCCTCTGACCCAGG -3'
(R):5'- GCGGCCTTCAGTTGCTCATATTTAC -3'
Posted On2018-04-05