Incidental Mutation 'FR4548:Triobp'
ID512118
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene NameTRIO and F-actin binding protein
SynonymsEST478828, Mus EST 478828, Tara
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #FR4548 ()
Quality Score212.637
Status Not validated
Chromosome15
Chromosomal Location78947724-79005869 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) TCG to TCGGCG at 78993387 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109687] [ENSMUST00000109688] [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000130663] [ENSMUST00000144151] [ENSMUST00000229270]
Predicted Effect probably benign
Transcript: ENSMUST00000109687
SMART Domains Protein: ENSMUSP00000105309
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
coiled coil region 339 377 N/A INTRINSIC
coiled coil region 401 463 N/A INTRINSIC
coiled coil region 497 576 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109688
SMART Domains Protein: ENSMUSP00000105310
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
low complexity region 30 47 N/A INTRINSIC
PH 54 151 6.2e-19 SMART
coiled coil region 324 351 N/A INTRINSIC
coiled coil region 386 424 N/A INTRINSIC
coiled coil region 448 510 N/A INTRINSIC
coiled coil region 544 623 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109689
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109690
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130663
SMART Domains Protein: ENSMUSP00000122988
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144151
SMART Domains Protein: ENSMUSP00000116765
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
PH 1 92 1.04e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230425
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 146 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik CTT CTTTTT 12: 110,668,449 probably benign Het
1700001K19Rik CTT CTTTTT 12: 110,668,452 probably benign Het
2010300C02Rik T A 1: 37,625,035 E594V probably benign Homo
2010300C02Rik C A 1: 37,625,036 E594* probably null Homo
2010300C02Rik A G 1: 37,625,102 S47P probably damaging Homo
4930433I11Rik ACCTC AC 7: 40,993,056 probably benign Het
4932415D10Rik G GTCATTA 10: 82,290,996 probably benign Homo
Abt1 TTCTTGCT TT 13: 23,423,711 probably benign Het
Ahdc1 TCC TCCCCC 4: 133,062,757 probably benign Homo
Ahdc1 T TCCC 4: 133,062,760 probably benign Homo
AI837181 CGG CGGGGG 19: 5,425,231 probably benign Het
AI837181 CG CGGGG 19: 5,425,237 probably benign Het
Anxa2 CCC CCCTCC 9: 69,480,203 probably benign Het
Anxa7 C T 14: 20,469,411 G113E probably damaging Homo
Apc CCAATAAAG CCAATAAAGACAATAAAG 18: 34,281,998 probably benign Het
Apol6 T TGTTA 15: 77,051,445 probably null Homo
BC051142 GCA GCATCA 17: 34,460,065 probably benign Het
Blm CTAC CTACTTAC 7: 80,463,769 probably null Homo
Brd2 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAAAAA 17: 34,116,336 probably benign Het
Bud31 C T 5: 145,146,535 R63C probably benign Het
C4b C T 17: 34,740,997 R335H probably benign Het
Cacna1a ACC ACCCCC 8: 84,638,717 probably benign Het
Cacna1f AGG AGGGGG X: 7,620,058 probably benign Het
Ccdc170 ACC ACCCCC 10: 4,561,026 probably benign Het
Cckbr GGGC G 7: 105,434,681 probably benign Homo
Cd3eap GGATG GG 7: 19,357,244 probably benign Homo
Cd80 GAAA GAAAAAA 16: 38,486,319 probably benign Homo
Ces1b T C 8: 93,068,092 N293S probably null Homo
Cgnl1 CGC CGCGGC 9: 71,724,717 probably benign Het
Cntnap1 CCCAGC CCCAGCGCCAGC 11: 101,189,572 probably benign Het
Cntnap1 CCAGCC CCAGCCTCAGCC 11: 101,189,579 probably benign Het
Cntnap1 AGCC AGCCCCCGCC 11: 101,189,593 probably benign Het
Cntnap1 GCC GCCCCAACC 11: 101,189,594 probably benign Het
Ctsm GTGA GTGAATGA 13: 61,537,837 probably null Homo
Cttnbp2 TGCTGC TGCTGCCGCTGC 6: 18,367,463 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,673 probably null Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Homo
Efna4 ATGTGAT A 3: 89,334,422 probably benign Homo
Eif3a A ATTTTT 19: 60,775,291 probably benign Homo
Ermn TTC TTCATC 2: 58,048,075 probably benign Het
Ermn TC TCTCC 2: 58,048,088 probably benign Het
Fbxo43 GTGCCT GTGCCTATGCCT 15: 36,152,098 probably null Het
Fscb A G 12: 64,472,563 S710P unknown Het
Fscb T A 12: 64,472,565 Q709L unknown Het
Glod4 A C 11: 76,243,310 probably benign Homo
Gm14401 A G 2: 177,086,868 D249G probably benign Het
Gm4340 AGC AGCCGC 10: 104,196,070 probably benign Het
Gm4340 AGC AGCGGC 10: 104,196,073 probably benign Het
Gm8104 C T 14: 43,110,009 T178I probably benign Het
Gm8104 T C 14: 43,110,011 S179P probably damaging Het
Gpatch11 GGAAGA GGAAGACGAAGA 17: 78,842,175 probably benign Het
H2-K1 GTTT G 17: 33,997,042 probably benign Homo
Hist1h1t GAGAA GA 13: 23,695,920 probably benign Homo
Hspa1b GCGCC GC 17: 34,957,129 probably benign Homo
Ifi211 G A 1: 173,906,193 A134V possibly damaging Het
Igf1r C CTGGAGATGGAGG 7: 68,226,186 probably benign Het
Igkv9-129 G A 6: 67,840,034 V41I probably damaging Het
Ipo9 TCC TCCCCC 1: 135,386,275 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Homo
Klra2 AG AGAAATCCACGG 6: 131,221,851 probably null Het
Kmt2b CTCC CTCCTCGTCC 7: 30,586,380 probably benign Het
Kng2 G A 16: 23,000,552 Q245* probably null Het
Kri1 CTCCTCTTCCTC CTCCTC 9: 21,281,050 probably benign Het
Krt10 TCCTCC TCCTCCCCCTCC 11: 99,389,273 probably benign Het
Krt10 TCCTCCAC TCCTCCACCTCCAC 11: 99,389,276 probably benign Homo
Las1l TC TCTTCCGC X: 95,940,625 probably benign Het
Las1l GAG GAGAAG X: 95,940,823 probably benign Het
Lrit3 GCT GCTACT 3: 129,788,813 probably benign Het
Lrit3 GCT GCTACT 3: 129,788,816 probably benign Het
Lrrc63 CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 14: 75,125,182 probably benign Homo
Luzp1 CTCTTCAGA CTCTTCAGAGGTGGCATCTTCAGA 4: 136,543,188 probably benign Homo
Mast4 CA CAGTGGGA 13: 102,736,318 probably benign Homo
Med12l AGC AGCGGC 3: 59,275,982 probably benign Het
Mn1 GCA GCACCA 5: 111,419,698 probably benign Het
Morn4 AGGCAGTGAG AGGCAGTGAGTCCGGCAGTGAG 19: 42,076,109 probably benign Het
Msantd4 A T 9: 4,384,937 I221F possibly damaging Homo
Mup21 TATACTT TATACTTTTTAAATACTT 4: 62,149,345 probably benign Het
Mup21 ATACTT ATACTTTTTATCTACTT 4: 62,149,346 probably benign Het
Nacad AGGGTC AGGGTCGGGGTC 11: 6,599,752 probably benign Het
Nacad GG GGCCAGTG 11: 6,599,760 probably benign Het
Ncapd2 CTT CTTGGTT 6: 125,173,596 probably benign Homo
Nelfe GACCGGGATCGAGACAGAGAC GACCGGGATCGAGACAGAGACAAAGACCGGGATCGAGACAGAGAC 17: 34,854,070 probably benign Homo
Nfxl1 CCGGGG CCGGGGTCGGGG 5: 72,559,115 probably benign Het
Nkx2-6 C T 14: 69,175,229 T282M probably damaging Homo
Noc2l AGGC AGGCGGC 4: 156,240,092 probably benign Homo
Noc2l GC GCTTC 4: 156,240,100 probably benign Het
Nphp3 CACG C 9: 104,025,939 probably benign Het
Nrg3 TTG TTGACACTG 14: 38,397,271 probably benign Homo
Olfr313 T A 11: 58,817,440 V144D possibly damaging Homo
Olfr318 T G 11: 58,720,371 I226L probably benign Het
Olfr585 T TTAG 7: 103,098,309 probably null Homo
Olfr624 CAAA CAAAAAA 7: 103,670,960 probably benign Homo
Olfr624 G GAAC 7: 103,670,967 probably null Homo
Osmr CTC CTCTTC 15: 6,837,703 probably benign Homo
Patl2 GCT GCTCCT 2: 122,126,135 probably benign Het
Pdik1l ACCAC ACCACCGCCAC 4: 134,279,512 probably benign Homo
Phldb3 GACCC G 7: 24,628,978 probably null Het
Piezo1 G A 8: 122,495,569 R503W probably damaging Homo
Pik3ap1 AG AGGGG 19: 41,281,945 probably benign Homo
Pkdrej TG TGGGAGCG 15: 85,819,680 probably benign Homo
Ppp1r3f C A X: 7,560,336 G562V probably damaging Homo
Prag1 GC GCAAC 8: 36,103,885 probably benign Homo
Prr13 TCC TCCGCC 15: 102,462,174 probably benign Het
Prtg GTAAC G 9: 72,857,081 probably benign Homo
Ptk2b C T 14: 66,173,849 R411Q possibly damaging Het
Ptms TTC TTCGTC 6: 124,914,456 probably benign Het
Ptpn23 G T 9: 110,387,633 P1052T probably benign Homo
Rbm33 AGCAGCCGCAGC AGCAGC 5: 28,394,201 probably benign Het
Setd1a TGGTGGTGGT TGGTGGTGGTGGTGGTGGT 7: 127,785,307 probably benign Homo
Setd1a TGGTAGTGG TGGTAGTGGCGGTAGTGG 7: 127,785,313 probably benign Homo
Sfswap CCACTCAGC CCACTCAGCGCACTCAGC 5: 129,569,749 probably benign Het
Sfswap AGCCCACTCGGCC AGCCCACTCGGCCCACTCGGCC 5: 129,569,755 probably benign Homo
Sh3pxd2b GT GTGTCTCT 11: 32,423,064 probably benign Homo
Sh3pxd2b T TGTCTTG 11: 32,423,065 probably benign Het
Shroom4 GCAGCAACA GCA X: 6,624,074 probably benign Het
Six3 GGC GGCCGC 17: 85,621,363 probably benign Het
Slc12a1 ACC ACCTTTGGCCACAACCCC 2: 125,154,214 probably benign Homo
Spaca1 GC GCTCTCTC 4: 34,049,856 probably benign Het
Spag17 AGG AGGCGG 3: 100,056,254 probably benign Het
Srebf2 G T 15: 82,185,335 A693S probably damaging Homo
Supt20 GCAGCA GCAGCACCAGCA 3: 54,727,657 probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,727,664 probably benign Het
Supt20 CA CAGCAGAA 3: 54,727,673 probably benign Het
Syne1 C A 10: 5,032,969 S8652I probably benign Homo
Tob1 GCA GCAACA 11: 94,214,455 probably benign Het
Tob1 AGC AGCCGC 11: 94,214,469 probably benign Het
Tomm5 CTTCCGC CTTCCGCATTTTCCGC 4: 45,107,977 probably benign Het
Trav15-2-dv6-2 G GAAA 14: 53,649,757 probably benign Het
Tsen2 GAG GAGAAG 6: 115,560,068 probably benign Het
Ttf2 TC TCCGC 3: 100,963,160 probably benign Homo
Tusc1 CGCCAC CGCCACTGCCAC 4: 93,335,303 probably benign Het
Ubtf CTC CTCATC 11: 102,306,958 probably benign Het
Utrn T TTCCTGTC 10: 12,633,941 probably benign Homo
Vars TGG TGGAGTCCTGGGGGG 17: 35,015,989 probably benign Homo
Vars G GAGTCCTGGGTGC 17: 35,015,991 probably benign Het
Vmn2r99 G A 17: 19,394,285 G756R probably damaging Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Homo
Zc3h13 TGCG TGCGTGATGAGCG 14: 75,323,599 probably benign Het
Zdhhc16 CACA CACAACAGGGAAAGCAGTCTGTCAACA 19: 41,942,168 probably null Het
Zfp26 C A 9: 20,438,546 A241S probably benign Homo
Zfp335 TCC TCCCCC 2: 164,907,472 probably benign Het
Zfp598 CACCAC CACCACAACCAC 17: 24,680,775 probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,680,776 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Zfp986 G T 4: 145,899,358 R196I probably benign Het
Zfp992 G T 4: 146,466,007 E62* probably null Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78993368 missense probably damaging 1.00
IGL01904:Triobp APN 15 78967364 missense possibly damaging 0.80
IGL01957:Triobp APN 15 78972647 critical splice donor site probably null
IGL02085:Triobp APN 15 78974297 splice site probably benign
IGL02260:Triobp APN 15 78966362 missense probably benign 0.00
IGL02498:Triobp APN 15 78961043 missense probably benign 0.01
IGL02551:Triobp APN 15 78973489 missense probably benign
IGL02740:Triobp APN 15 78966689 missense probably benign 0.21
IGL02810:Triobp APN 15 79002203 missense possibly damaging 0.95
IGL03063:Triobp APN 15 78990884 missense probably damaging 1.00
FR4304:Triobp UTSW 15 78993387 unclassified probably benign
FR4340:Triobp UTSW 15 78993390 unclassified probably benign
FR4342:Triobp UTSW 15 78993392 unclassified probably benign
FR4449:Triobp UTSW 15 78993389 unclassified probably benign
FR4548:Triobp UTSW 15 78993390 unclassified probably benign
R0276:Triobp UTSW 15 78973676 missense probably benign 0.09
R0309:Triobp UTSW 15 78976540 missense probably damaging 1.00
R0433:Triobp UTSW 15 78968201 missense possibly damaging 0.69
R0464:Triobp UTSW 15 78966986 missense possibly damaging 0.71
R0525:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0665:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0689:Triobp UTSW 15 78959988 nonsense probably null
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1151:Triobp UTSW 15 78966479 missense probably benign 0.00
R1152:Triobp UTSW 15 78966479 missense probably benign 0.00
R1510:Triobp UTSW 15 79003767 missense probably damaging 1.00
R1519:Triobp UTSW 15 78973738 missense probably benign 0.00
R1642:Triobp UTSW 15 79002148 missense probably damaging 1.00
R1732:Triobp UTSW 15 78967228 missense possibly damaging 0.69
R1755:Triobp UTSW 15 78966479 missense probably benign 0.00
R1975:Triobp UTSW 15 78966708 missense probably benign
R2051:Triobp UTSW 15 79004540 missense probably damaging 1.00
R2073:Triobp UTSW 15 78973895 missense probably damaging 0.99
R2260:Triobp UTSW 15 78991440 critical splice donor site probably null
R2351:Triobp UTSW 15 79004580 missense probably benign 0.09
R2902:Triobp UTSW 15 78973418 missense possibly damaging 0.90
R3801:Triobp UTSW 15 78973700 missense probably benign 0.04
R3959:Triobp UTSW 15 79002389 nonsense probably null
R4003:Triobp UTSW 15 78959977 unclassified probably benign
R4084:Triobp UTSW 15 78973671 missense probably benign 0.19
R4482:Triobp UTSW 15 78966563 missense possibly damaging 0.87
R4592:Triobp UTSW 15 78967095 missense probably benign
R4662:Triobp UTSW 15 78993269 missense probably damaging 1.00
R4732:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4733:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4789:Triobp UTSW 15 78991028 missense probably damaging 1.00
R4968:Triobp UTSW 15 78966616 missense probably benign 0.03
R4990:Triobp UTSW 15 78967005 missense probably benign 0.00
R5129:Triobp UTSW 15 78961096 missense probably benign 0.15
R5181:Triobp UTSW 15 78967754 missense probably benign 0.00
R5279:Triobp UTSW 15 78994391 missense possibly damaging 0.66
R5584:Triobp UTSW 15 78968132 missense possibly damaging 0.89
R5601:Triobp UTSW 15 78973633 missense probably damaging 1.00
R5810:Triobp UTSW 15 78968267 missense probably benign 0.07
R5969:Triobp UTSW 15 78967540 missense probably benign 0.05
R6722:Triobp UTSW 15 79001565 missense probably damaging 1.00
R6739:Triobp UTSW 15 78966366 missense possibly damaging 0.77
R6810:Triobp UTSW 15 78966615 missense possibly damaging 0.47
X0026:Triobp UTSW 15 78960023 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCAACGCTCTGAGGAAAGAC -3'
(R):5'- GCAGTGCAAAGCTTCAGTCC -3'

Sequencing Primer
(F):5'- TGGTTCGAGTCCACGGAC -3'
(R):5'- AAAGCTTCAGTCCCTGTGAG -3'
Posted On2018-04-05