Incidental Mutation 'R6132:S1pr4'
ID512264
Institutional Source Beutler Lab
Gene Symbol S1pr4
Ensembl Gene ENSMUSG00000044199
Gene Namesphingosine-1-phosphate receptor 4
SynonymsS1P4, lpC1, Edg6
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6132 (G1)
Quality Score59.0073
Status Validated
Chromosome10
Chromosomal Location81497747-81500132 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81499196 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 148 (A148V)
Ref Sequence ENSEMBL: ENSMUSP00000050412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020463] [ENSMUST00000043709] [ENSMUST00000053646] [ENSMUST00000118498]
Predicted Effect probably benign
Transcript: ENSMUST00000020463
SMART Domains Protein: ENSMUSP00000020463
Gene: ENSMUSG00000020238

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 160 172 N/A INTRINSIC
Pfam:Peptidase_M28 205 421 1.8e-13 PFAM
Pfam:Nicastrin 217 411 2.1e-9 PFAM
transmembrane domain 521 543 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043709
SMART Domains Protein: ENSMUSP00000049175
Gene: ENSMUSG00000034792

DomainStartEndE-ValueType
G_alpha 22 373 1.22e-188 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000053646
AA Change: A148V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000050412
Gene: ENSMUSG00000044199
AA Change: A148V

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
Pfam:7tm_1 66 309 1.2e-32 PFAM
low complexity region 324 337 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118498
SMART Domains Protein: ENSMUSP00000112744
Gene: ENSMUSG00000020238

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 160 172 N/A INTRINSIC
Pfam:Peptidase_M28 217 395 3.9e-12 PFAM
Pfam:Nicastrin 217 411 1.5e-10 PFAM
transmembrane domain 520 542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151680
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: This gene encodes a member of the G-protein coupled receptor 1 family. The encoded protein is a receptor for the lysophospholipid sphingosine 1-phosphate. The encoded protein is one of the predominant sphingosine 1-phosphate G-protein coupled receptors expressed in T cells, and it plays a role in suppression of T cell proliferation, generation of cytokines, and potentially other aspects of immune activation. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mutation of this gene results in mid-gestation embryonic lethality. Heterozygotes exhibit decreased prepulse inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik C T 4: 41,517,160 M1I probably null Het
Abca15 T C 7: 120,361,420 Y702H probably benign Het
Adgrv1 G T 13: 81,506,076 N2225K probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alkbh5 G T 11: 60,537,995 probably benign Het
Atp5g1 A G 11: 96,075,024 M1T probably null Het
Crebrf C T 17: 26,763,403 P588S probably benign Het
Ctsr A C 13: 61,161,768 probably null Het
Cyp2c68 A G 19: 39,703,414 V355A possibly damaging Het
Ddx52 A G 11: 83,959,457 K555E possibly damaging Het
Depdc5 T A 5: 32,910,467 S410T probably damaging Het
Dhx30 A T 9: 110,085,779 I884N probably damaging Het
Dlg1 A T 16: 31,836,241 N518I possibly damaging Het
Dnah12 T A 14: 26,717,911 I506N probably damaging Het
Efcab6 A G 15: 84,032,972 L129P probably damaging Het
Erap1 A G 13: 74,660,282 N38D probably benign Het
Esf1 A G 2: 140,159,779 F383L probably benign Het
Exoc4 A G 6: 33,758,098 E550G probably damaging Het
Fbxo44 G A 4: 148,156,108 T221I probably benign Het
Gal3st2b A T 1: 93,939,966 M112L possibly damaging Het
Golph3l C G 3: 95,591,834 P96A probably benign Het
Gprc6a T A 10: 51,615,260 I727F possibly damaging Het
Grin3b T C 10: 79,976,440 L479P probably damaging Het
Kdm5a C T 6: 120,374,931 H161Y probably damaging Het
Lman2 A G 13: 55,362,225 S73P probably benign Het
Map3k19 T C 1: 127,850,476 N4S possibly damaging Het
Mkln1 G A 6: 31,431,220 V161M probably damaging Het
Mmel1 C T 4: 154,895,018 H728Y probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Nrcam T A 12: 44,570,224 Y668N probably damaging Het
Oacyl G T 18: 65,726,355 G255W probably damaging Het
Olfr201 A G 16: 59,269,004 V221A probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr994 A T 2: 85,430,146 S228T probably benign Het
Omd A C 13: 49,590,367 I298L probably damaging Het
Otor A T 2: 143,078,600 D34V probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Pwwp2a A G 11: 43,705,628 Y540C probably damaging Het
Rttn T A 18: 89,115,646 probably null Het
Scn10a C T 9: 119,613,695 V1495M possibly damaging Het
Sel1l3 T C 5: 53,200,189 K154E possibly damaging Het
Sema3a T G 5: 13,523,175 probably null Het
Slf2 T A 19: 44,960,861 N870K possibly damaging Het
Syne2 T C 12: 75,945,147 V1962A probably benign Het
Tarbp1 T A 8: 126,434,809 I1219F probably benign Het
Tet1 A C 10: 62,813,300 C173W probably damaging Het
Tnn A G 1: 160,146,071 F242S probably damaging Het
Tollip A G 7: 141,889,597 S174P probably benign Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn2r106 T C 17: 20,268,404 T578A probably benign Het
Zfp457 G T 13: 67,293,296 S309* probably null Het
Other mutations in S1pr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02348:S1pr4 APN 10 81499021 nonsense probably null
R0446:S1pr4 UTSW 10 81498989 missense probably damaging 0.98
R1605:S1pr4 UTSW 10 81499391 unclassified probably null
R1797:S1pr4 UTSW 10 81499190 missense probably damaging 1.00
R2504:S1pr4 UTSW 10 81499304 missense probably benign 0.01
R2858:S1pr4 UTSW 10 81499239 missense probably damaging 1.00
R2943:S1pr4 UTSW 10 81498872 missense probably damaging 1.00
R5849:S1pr4 UTSW 10 81499323 missense possibly damaging 0.95
R6235:S1pr4 UTSW 10 81498882 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACATAGCCCTTGGAGTAGAGG -3'
(R):5'- ATCGCCATCTACATGCGGTC -3'

Sequencing Primer
(F):5'- CCCTTGGAGTAGAGGGGCAG -3'
(R):5'- GGTGTACTACTGCCTGCTGAAC -3'
Posted On2018-04-13