Incidental Mutation 'R6353:Baiap2l1'
ID 512292
Institutional Source Beutler Lab
Gene Symbol Baiap2l1
Ensembl Gene ENSMUSG00000038859
Gene Name BAI1-associated protein 2-like 1
Synonyms 1300006M19Rik, IRTKS
MMRRC Submission 044505-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6353 (G1)
Quality Score 122.008
Status Not validated
Chromosome 5
Chromosomal Location 144201336-144294922 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 144218898 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 237 (E237K)
Ref Sequence ENSEMBL: ENSMUSP00000053129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055190] [ENSMUST00000155491]
AlphaFold Q9DBJ3
PDB Structure Solution Structure of RSGI RUH-010, an SH3 Domain from Mouse cDNA [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055190
AA Change: E237K

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053129
Gene: ENSMUSG00000038859
AA Change: E237K

DomainStartEndE-ValueType
Pfam:IMD 16 236 4.4e-65 PFAM
SH3 343 402 1.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129287
Predicted Effect probably benign
Transcript: ENSMUST00000155491
SMART Domains Protein: ENSMUSP00000122016
Gene: ENSMUSG00000047843

DomainStartEndE-ValueType
Pfam:DUF2367 27 90 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198873
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IMD (IRSp53/MIM homology domain) family. Members of this family can be subdivided in two groups, the IRSp53-like and MIM-like, based on the presence or absence of the SH3 (Src homology 3) domain. The protein encoded by this gene contains a conserved IMD, also known as F-actin bundling domain, at the N-terminus, and a canonical SH3 domain near the C-terminus, so it belongs to the IRSp53-like group. This protein is the substrate for insulin receptor tyrosine kinase and binds to the small GTPase Rac. It is involved in signal transduction pathways that link deformation of the plasma membrane and remodeling of the actin cytoskeleton. It also promotes actin assembly and membrane protrusions when overexpressed in mammalian cells, and is essential to the formation of a potent actin assembly complex during EHEC (Enterohemorrhagic Escherichia coli) pedestal formation. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased circulating glucose and insulin levels, impaired glucose tolerance and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik C A 9: 53,325,642 (GRCm39) Q60K probably benign Het
Aadacl2fm2 A T 3: 59,659,529 (GRCm39) L327F probably damaging Het
Aamp T C 1: 74,319,987 (GRCm39) D397G probably benign Het
Aco1 G A 4: 40,186,367 (GRCm39) R593Q probably benign Het
Acta1 T C 8: 124,620,426 (GRCm39) E4G probably benign Het
Apob A T 12: 8,059,421 (GRCm39) K2601N probably damaging Het
Arpin C A 7: 79,585,093 (GRCm39) probably benign Het
Asnsd1 T C 1: 53,386,938 (GRCm39) I230V probably benign Het
Chek1 T C 9: 36,635,255 (GRCm39) K43E probably benign Het
Clec2g T A 6: 128,959,895 (GRCm39) probably null Het
Cnot10 A G 9: 114,426,614 (GRCm39) L646P probably damaging Het
Cyp2j9 T C 4: 96,474,135 (GRCm39) T102A probably benign Het
Dnase1l2 A T 17: 24,661,219 (GRCm39) L30Q probably damaging Het
Edc3 T C 9: 57,623,520 (GRCm39) S152P probably benign Het
Gask1b A T 3: 79,848,647 (GRCm39) R464S probably damaging Het
Gpr160 A T 3: 30,950,171 (GRCm39) D81V probably damaging Het
Intu A T 3: 40,608,138 (GRCm39) D32V probably damaging Het
Itga5 T C 15: 103,260,950 (GRCm39) E512G probably damaging Het
Khnyn T C 14: 56,131,760 (GRCm39) F561L possibly damaging Het
Kmt2e T A 5: 23,698,243 (GRCm39) V645E probably damaging Het
Mcoln3 T C 3: 145,836,909 (GRCm39) F247S probably damaging Het
Nek9 G A 12: 85,348,603 (GRCm39) T977I probably damaging Het
Nphs1 A G 7: 30,173,969 (GRCm39) T1015A probably damaging Het
Ntmt2 A G 1: 163,531,680 (GRCm39) Y158H possibly damaging Het
Nudcd1 T C 15: 44,284,158 (GRCm39) Y76C probably damaging Het
Or2a54 C A 6: 43,093,070 (GRCm39) Y131* probably null Het
Or8b44 T C 9: 38,410,112 (GRCm39) I49T probably benign Het
Pgd C T 4: 149,245,209 (GRCm39) probably null Het
Prl7c1 A G 13: 27,957,709 (GRCm39) S244P possibly damaging Het
Rpap1 G T 2: 119,607,377 (GRCm39) probably null Het
Rrp8 G A 7: 105,383,325 (GRCm39) R314* probably null Het
Smarca4 T A 9: 21,590,445 (GRCm39) probably null Het
Stambpl1 A G 19: 34,211,520 (GRCm39) probably null Het
Tmeff2 T C 1: 51,220,985 (GRCm39) V320A probably damaging Het
Top2b A G 14: 16,416,671 (GRCm38) K83E probably damaging Het
Ttc39b C G 4: 83,148,730 (GRCm39) V560L probably benign Het
Ttn A T 2: 76,672,153 (GRCm39) probably benign Het
Usp32 T C 11: 84,913,107 (GRCm39) I934V probably benign Het
Uxs1 T C 1: 43,836,410 (GRCm39) I122V probably damaging Het
Vmn1r168 A G 7: 23,240,944 (GRCm39) N267S probably benign Het
Vmn2r16 A G 5: 109,488,119 (GRCm39) N331D probably benign Het
Other mutations in Baiap2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Baiap2l1 APN 5 144,222,879 (GRCm39) splice site probably null
IGL00789:Baiap2l1 APN 5 144,222,356 (GRCm39) nonsense probably null
IGL00922:Baiap2l1 APN 5 144,255,777 (GRCm39) missense probably damaging 1.00
IGL01446:Baiap2l1 APN 5 144,212,723 (GRCm39) missense probably benign 0.10
IGL01603:Baiap2l1 APN 5 144,217,625 (GRCm39) intron probably benign
IGL02748:Baiap2l1 APN 5 144,203,415 (GRCm39) intron probably benign
IGL03348:Baiap2l1 APN 5 144,215,341 (GRCm39) missense probably benign 0.08
PIT4382001:Baiap2l1 UTSW 5 144,215,480 (GRCm39) missense possibly damaging 0.71
R0066:Baiap2l1 UTSW 5 144,221,372 (GRCm39) missense probably damaging 1.00
R0066:Baiap2l1 UTSW 5 144,221,372 (GRCm39) missense probably damaging 1.00
R0110:Baiap2l1 UTSW 5 144,212,701 (GRCm39) missense probably damaging 1.00
R0197:Baiap2l1 UTSW 5 144,202,820 (GRCm39) missense probably damaging 0.96
R0469:Baiap2l1 UTSW 5 144,212,701 (GRCm39) missense probably damaging 1.00
R0744:Baiap2l1 UTSW 5 144,203,451 (GRCm39) missense probably benign 0.21
R0755:Baiap2l1 UTSW 5 144,221,367 (GRCm39) missense probably damaging 0.97
R0765:Baiap2l1 UTSW 5 144,214,513 (GRCm39) missense probably damaging 0.99
R1051:Baiap2l1 UTSW 5 144,222,943 (GRCm39) missense probably damaging 1.00
R1809:Baiap2l1 UTSW 5 144,261,365 (GRCm39) critical splice donor site probably null
R3889:Baiap2l1 UTSW 5 144,215,345 (GRCm39) missense possibly damaging 0.67
R4451:Baiap2l1 UTSW 5 144,215,362 (GRCm39) missense probably damaging 1.00
R5093:Baiap2l1 UTSW 5 144,215,363 (GRCm39) missense probably damaging 1.00
R5471:Baiap2l1 UTSW 5 144,218,951 (GRCm39) missense probably benign 0.01
R5523:Baiap2l1 UTSW 5 144,212,768 (GRCm39) missense probably damaging 1.00
R5524:Baiap2l1 UTSW 5 144,217,759 (GRCm39) missense probably benign 0.01
R5586:Baiap2l1 UTSW 5 144,218,949 (GRCm39) missense probably damaging 0.99
R5603:Baiap2l1 UTSW 5 144,202,787 (GRCm39) missense probably damaging 1.00
R5735:Baiap2l1 UTSW 5 144,223,112 (GRCm39) missense probably damaging 1.00
R6572:Baiap2l1 UTSW 5 144,223,112 (GRCm39) missense probably damaging 1.00
R6619:Baiap2l1 UTSW 5 144,222,916 (GRCm39) missense probably benign 0.22
R6981:Baiap2l1 UTSW 5 144,222,389 (GRCm39) missense possibly damaging 0.94
R7218:Baiap2l1 UTSW 5 144,212,687 (GRCm39) missense probably benign 0.01
R7352:Baiap2l1 UTSW 5 144,261,436 (GRCm39) missense probably benign 0.03
R7662:Baiap2l1 UTSW 5 144,294,700 (GRCm39) intron probably benign
R7797:Baiap2l1 UTSW 5 144,255,760 (GRCm39) missense probably damaging 1.00
R7981:Baiap2l1 UTSW 5 144,294,700 (GRCm39) intron probably benign
R8170:Baiap2l1 UTSW 5 144,214,502 (GRCm39) nonsense probably null
R8308:Baiap2l1 UTSW 5 144,214,487 (GRCm39) missense probably benign 0.06
R8333:Baiap2l1 UTSW 5 144,217,691 (GRCm39) missense possibly damaging 0.89
R8673:Baiap2l1 UTSW 5 144,212,852 (GRCm39) intron probably benign
R8976:Baiap2l1 UTSW 5 144,223,117 (GRCm39) missense probably benign 0.03
R9187:Baiap2l1 UTSW 5 144,217,764 (GRCm39) missense probably benign 0.01
X0022:Baiap2l1 UTSW 5 144,215,462 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCAGTCCTGGTCCTTTG -3'
(R):5'- GCCTCTTCAGCAACTGAGAC -3'

Sequencing Primer
(F):5'- GGGTCAGTTTGAACTAATGCATAC -3'
(R):5'- TAAACTGCTGAGTTAGACTGTGAGCC -3'
Posted On 2018-04-27