Incidental Mutation 'R6357:Klhdc8a'
ID512363
Institutional Source Beutler Lab
Gene Symbol Klhdc8a
Ensembl Gene ENSMUSG00000042115
Gene Namekelch domain containing 8A
SynonymsA630065K24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R6357 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location132298626-132307357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132303153 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 252 (Q252L)
Ref Sequence ENSEMBL: ENSMUSP00000038297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046071]
Predicted Effect probably damaging
Transcript: ENSMUST00000046071
AA Change: Q252L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038297
Gene: ENSMUSG00000042115
AA Change: Q252L

DomainStartEndE-ValueType
Kelch 32 79 1.05e-11 SMART
Kelch 80 127 1.1e-1 SMART
Kelch 128 174 9.37e-2 SMART
Kelch 176 222 8.34e-6 SMART
Blast:Kelch 224 278 3e-9 BLAST
Kelch 279 326 6.82e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kelch domain-containing protein which is upregulated in cancer. Upregulated expression of the encoded protein may provide an alternative pathway for tumors to maintain aggressiveness in the absence of epidermal growth factor receptor dependence. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,930,974 M303V probably benign Het
1700061G19Rik T C 17: 56,877,591 probably null Het
3632451O06Rik A T 14: 49,773,312 S313T probably benign Het
Calcr T C 6: 3,714,710 D140G probably benign Het
Card10 T C 15: 78,799,379 E188G probably damaging Het
Cenpq T C 17: 40,924,527 E193G probably damaging Het
Cep164 G A 9: 45,770,884 L1874F probably damaging Het
Dennd3 T C 15: 73,556,472 M889T possibly damaging Het
Dnah9 T C 11: 65,874,196 K3841E probably damaging Het
Eci2 A G 13: 34,993,099 V26A possibly damaging Het
Eftud2 A T 11: 102,864,780 N200K probably damaging Het
Eml5 T A 12: 98,870,884 H357L probably damaging Het
Esam T C 9: 37,537,780 *395R probably null Het
Fam205a1 T A 4: 42,850,393 I588F probably damaging Het
Galt C T 4: 41,757,565 P246S probably benign Het
Gjb3 A T 4: 127,326,630 Y36* probably null Het
Gli2 T C 1: 118,841,959 E621G probably damaging Het
Gls T C 1: 52,219,506 D201G probably damaging Het
Gm10801 C CGTCA 2: 98,663,807 probably null Het
Gm1110 T C 9: 26,914,128 probably null Het
Gm5565 T A 5: 146,160,473 H13L possibly damaging Het
Hydin A C 8: 110,541,657 T2923P possibly damaging Het
Kank1 A T 19: 25,411,353 I797L probably benign Het
Kmt5c T C 7: 4,742,205 F65S possibly damaging Het
Lix1 C T 17: 17,445,993 P138L probably benign Het
Lnpep T C 17: 17,552,914 N664S probably benign Het
Msh6 T A 17: 87,984,460 Y214* probably null Het
Nefl A G 14: 68,084,318 E119G probably damaging Het
Nptxr C A 15: 79,794,315 R257L possibly damaging Het
Olfr726 C A 14: 50,083,989 A231S probably damaging Het
Olfr866 T A 9: 20,027,629 Q103L probably damaging Het
Oxct2b A G 4: 123,116,916 I210V probably benign Het
Plppr3 T A 10: 79,865,406 Q534L probably benign Het
Psma1 T C 7: 114,274,367 probably null Het
Rbp3 G A 14: 33,957,034 A980T probably damaging Het
Ripply2 T A 9: 87,016,278 S58R possibly damaging Het
Robo1 T C 16: 72,970,302 V454A probably benign Het
Sacs A G 14: 61,208,824 D2773G possibly damaging Het
Sirpb1b A T 3: 15,503,183 V366E possibly damaging Het
Slc5a7 T C 17: 54,287,361 I197M probably benign Het
Srgap2 T C 1: 131,355,542 Y267C probably damaging Het
Ssc4d T C 5: 135,966,096 T189A probably benign Het
Tas2r106 A G 6: 131,677,962 *309Q probably null Het
Tctex1d2 T G 16: 32,429,055 probably null Het
Theg T C 10: 79,586,955 S38G probably benign Het
Vmn2r44 T C 7: 8,370,658 M511V probably benign Het
Wdfy4 G T 14: 33,101,049 Y1364* probably null Het
Zbtb8a T C 4: 129,354,299 H393R probably benign Het
Other mutations in Klhdc8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Klhdc8a APN 1 132303018 missense probably benign
IGL01106:Klhdc8a APN 1 132304700 missense probably benign 0.01
IGL02512:Klhdc8a APN 1 132303157 critical splice donor site probably null
R0015:Klhdc8a UTSW 1 132303005 missense probably damaging 0.99
R1442:Klhdc8a UTSW 1 132302647 missense possibly damaging 0.94
R1845:Klhdc8a UTSW 1 132303810 missense possibly damaging 0.80
R4857:Klhdc8a UTSW 1 132303105 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATAGAGTCTCGGTCCTGGAC -3'
(R):5'- CTGCACAAATACTGGGGATGG -3'

Sequencing Primer
(F):5'- GTCCTGGACCAAGTTCCCC -3'
(R):5'- CAGGCCAAAGGAGCCTTG -3'
Posted On2018-04-27