Incidental Mutation 'R6357:Sirpb1b'
ID512365
Institutional Source Beutler Lab
Gene Symbol Sirpb1b
Ensembl Gene ENSMUSG00000095028
Gene Namesignal-regulatory protein beta 1B
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6357 (G1)
Quality Score219.009
Status Not validated
Chromosome3
Chromosomal Location15495751-15575065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15503183 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 366 (V366E)
Ref Sequence ENSEMBL: ENSMUSP00000088869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091319] [ENSMUST00000192382]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091319
AA Change: V366E

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088869
Gene: ENSMUSG00000095028
AA Change: V366E

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
IG 37 143 8.19e-9 SMART
IGc1 163 236 1.22e-4 SMART
IGc1 266 339 2.21e-5 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192382
AA Change: V372E

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000142068
Gene: ENSMUSG00000095028
AA Change: V372E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IG 37 143 3.3e-11 SMART
IGc1 163 236 5.1e-7 SMART
Pfam:C2-set_2 251 340 1e-4 PFAM
Pfam:Ig_2 251 348 2.7e-1 PFAM
Pfam:C1-set 258 341 1.3e-13 PFAM
transmembrane domain 370 392 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,930,974 M303V probably benign Het
1700061G19Rik T C 17: 56,877,591 probably null Het
3632451O06Rik A T 14: 49,773,312 S313T probably benign Het
Calcr T C 6: 3,714,710 D140G probably benign Het
Card10 T C 15: 78,799,379 E188G probably damaging Het
Cenpq T C 17: 40,924,527 E193G probably damaging Het
Cep164 G A 9: 45,770,884 L1874F probably damaging Het
Dennd3 T C 15: 73,556,472 M889T possibly damaging Het
Dnah9 T C 11: 65,874,196 K3841E probably damaging Het
Eci2 A G 13: 34,993,099 V26A possibly damaging Het
Eftud2 A T 11: 102,864,780 N200K probably damaging Het
Eml5 T A 12: 98,870,884 H357L probably damaging Het
Esam T C 9: 37,537,780 *395R probably null Het
Fam205a1 T A 4: 42,850,393 I588F probably damaging Het
Galt C T 4: 41,757,565 P246S probably benign Het
Gjb3 A T 4: 127,326,630 Y36* probably null Het
Gli2 T C 1: 118,841,959 E621G probably damaging Het
Gls T C 1: 52,219,506 D201G probably damaging Het
Gm10801 C CGTCA 2: 98,663,807 probably null Het
Gm1110 T C 9: 26,914,128 probably null Het
Gm5565 T A 5: 146,160,473 H13L possibly damaging Het
Hydin A C 8: 110,541,657 T2923P possibly damaging Het
Kank1 A T 19: 25,411,353 I797L probably benign Het
Klhdc8a A T 1: 132,303,153 Q252L probably damaging Het
Kmt5c T C 7: 4,742,205 F65S possibly damaging Het
Lix1 C T 17: 17,445,993 P138L probably benign Het
Lnpep T C 17: 17,552,914 N664S probably benign Het
Msh6 T A 17: 87,984,460 Y214* probably null Het
Nefl A G 14: 68,084,318 E119G probably damaging Het
Nptxr C A 15: 79,794,315 R257L possibly damaging Het
Olfr726 C A 14: 50,083,989 A231S probably damaging Het
Olfr866 T A 9: 20,027,629 Q103L probably damaging Het
Oxct2b A G 4: 123,116,916 I210V probably benign Het
Plppr3 T A 10: 79,865,406 Q534L probably benign Het
Psma1 T C 7: 114,274,367 probably null Het
Rbp3 G A 14: 33,957,034 A980T probably damaging Het
Ripply2 T A 9: 87,016,278 S58R possibly damaging Het
Robo1 T C 16: 72,970,302 V454A probably benign Het
Sacs A G 14: 61,208,824 D2773G possibly damaging Het
Slc5a7 T C 17: 54,287,361 I197M probably benign Het
Srgap2 T C 1: 131,355,542 Y267C probably damaging Het
Ssc4d T C 5: 135,966,096 T189A probably benign Het
Tas2r106 A G 6: 131,677,962 *309Q probably null Het
Tctex1d2 T G 16: 32,429,055 probably null Het
Theg T C 10: 79,586,955 S38G probably benign Het
Vmn2r44 T C 7: 8,370,658 M511V probably benign Het
Wdfy4 G T 14: 33,101,049 Y1364* probably null Het
Zbtb8a T C 4: 129,354,299 H393R probably benign Het
Other mutations in Sirpb1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Sirpb1b APN 3 15548729 missense probably damaging 0.99
IGL01662:Sirpb1b APN 3 15543184 missense probably damaging 1.00
IGL02025:Sirpb1b APN 3 15548803 missense probably damaging 0.99
F5770:Sirpb1b UTSW 3 15503183 missense probably benign 0.25
R0419:Sirpb1b UTSW 3 15548596 missense probably damaging 1.00
R1538:Sirpb1b UTSW 3 15548759 missense possibly damaging 0.81
R3935:Sirpb1b UTSW 3 15548783 missense probably benign 0.05
R4300:Sirpb1b UTSW 3 15548761 missense probably damaging 1.00
R4373:Sirpb1b UTSW 3 15548761 missense probably damaging 1.00
R4953:Sirpb1b UTSW 3 15548827 missense probably damaging 1.00
R5425:Sirpb1b UTSW 3 15548669 missense probably damaging 1.00
R6340:Sirpb1b UTSW 3 15548665 missense probably damaging 1.00
R6723:Sirpb1b UTSW 3 15548798 missense possibly damaging 0.78
R7152:Sirpb1b UTSW 3 15542170 missense probably benign 0.25
V7583:Sirpb1b UTSW 3 15503183 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AATAGCATGACCCTCCTATTCATCC -3'
(R):5'- CCATGTCTTCTAAGTTGAACTACTG -3'

Sequencing Primer
(F):5'- GAAATGTGTGCACTCAGCTC -3'
(R):5'- CTGAATTTAATGGTGAAAGAGAACAC -3'
Posted On2018-04-27