Incidental Mutation 'R6357:Psma1'
ID512378
Institutional Source Beutler Lab
Gene Symbol Psma1
Ensembl Gene ENSMUSG00000030751
Gene Nameproteasome (prosome, macropain) subunit, alpha type 1
SynonymsC2, HC2, Pros-30
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R6357 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location114264606-114276118 bp(-) (GRCm38)
Type of Mutationintron (49 bp from exon)
DNA Base Change (assembly) T to C at 114274367 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033008] [ENSMUST00000135570]
Predicted Effect probably null
Transcript: ENSMUST00000033008
SMART Domains Protein: ENSMUSP00000033008
Gene: ENSMUSG00000030751

DomainStartEndE-ValueType
Proteasome_A_N 6 28 6.32e-8 SMART
Pfam:Proteasome 29 215 3.2e-54 PFAM
low complexity region 243 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123801
Predicted Effect probably null
Transcript: ENSMUST00000135570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210966
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,930,974 M303V probably benign Het
1700061G19Rik T C 17: 56,877,591 probably null Het
3632451O06Rik A T 14: 49,773,312 S313T probably benign Het
Calcr T C 6: 3,714,710 D140G probably benign Het
Card10 T C 15: 78,799,379 E188G probably damaging Het
Cenpq T C 17: 40,924,527 E193G probably damaging Het
Cep164 G A 9: 45,770,884 L1874F probably damaging Het
Dennd3 T C 15: 73,556,472 M889T possibly damaging Het
Dnah9 T C 11: 65,874,196 K3841E probably damaging Het
Eci2 A G 13: 34,993,099 V26A possibly damaging Het
Eftud2 A T 11: 102,864,780 N200K probably damaging Het
Eml5 T A 12: 98,870,884 H357L probably damaging Het
Esam T C 9: 37,537,780 *395R probably null Het
Fam205a1 T A 4: 42,850,393 I588F probably damaging Het
Galt C T 4: 41,757,565 P246S probably benign Het
Gjb3 A T 4: 127,326,630 Y36* probably null Het
Gli2 T C 1: 118,841,959 E621G probably damaging Het
Gls T C 1: 52,219,506 D201G probably damaging Het
Gm10801 C CGTCA 2: 98,663,807 probably null Het
Gm1110 T C 9: 26,914,128 probably null Het
Gm5565 T A 5: 146,160,473 H13L possibly damaging Het
Hydin A C 8: 110,541,657 T2923P possibly damaging Het
Kank1 A T 19: 25,411,353 I797L probably benign Het
Klhdc8a A T 1: 132,303,153 Q252L probably damaging Het
Kmt5c T C 7: 4,742,205 F65S possibly damaging Het
Lix1 C T 17: 17,445,993 P138L probably benign Het
Lnpep T C 17: 17,552,914 N664S probably benign Het
Msh6 T A 17: 87,984,460 Y214* probably null Het
Nefl A G 14: 68,084,318 E119G probably damaging Het
Nptxr C A 15: 79,794,315 R257L possibly damaging Het
Olfr726 C A 14: 50,083,989 A231S probably damaging Het
Olfr866 T A 9: 20,027,629 Q103L probably damaging Het
Oxct2b A G 4: 123,116,916 I210V probably benign Het
Plppr3 T A 10: 79,865,406 Q534L probably benign Het
Rbp3 G A 14: 33,957,034 A980T probably damaging Het
Ripply2 T A 9: 87,016,278 S58R possibly damaging Het
Robo1 T C 16: 72,970,302 V454A probably benign Het
Sacs A G 14: 61,208,824 D2773G possibly damaging Het
Sirpb1b A T 3: 15,503,183 V366E possibly damaging Het
Slc5a7 T C 17: 54,287,361 I197M probably benign Het
Srgap2 T C 1: 131,355,542 Y267C probably damaging Het
Ssc4d T C 5: 135,966,096 T189A probably benign Het
Tas2r106 A G 6: 131,677,962 *309Q probably null Het
Tctex1d2 T G 16: 32,429,055 probably null Het
Theg T C 10: 79,586,955 S38G probably benign Het
Vmn2r44 T C 7: 8,370,658 M511V probably benign Het
Wdfy4 G T 14: 33,101,049 Y1364* probably null Het
Zbtb8a T C 4: 129,354,299 H393R probably benign Het
Other mutations in Psma1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03001:Psma1 APN 7 114266439 missense probably benign 0.01
R0046:Psma1 UTSW 7 114267205 splice site probably benign
R0046:Psma1 UTSW 7 114267205 splice site probably benign
R2062:Psma1 UTSW 7 114269766 missense possibly damaging 0.95
R2217:Psma1 UTSW 7 114264938 missense unknown
R4633:Psma1 UTSW 7 114271134 missense probably damaging 1.00
R5585:Psma1 UTSW 7 114274067 missense probably damaging 1.00
R7137:Psma1 UTSW 7 114274448 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCTATAATCTCACAAGCTTTG -3'
(R):5'- TGCATTGCAAACTGAGTGCTG -3'

Sequencing Primer
(F):5'- CCTATAATCTCACAAGCTTTGTTTCC -3'
(R):5'- TGTCTCAAGAAAGCTGCACTAG -3'
Posted On2018-04-27