Incidental Mutation 'R6357:Msh6'
ID512407
Institutional Source Beutler Lab
Gene Symbol Msh6
Ensembl Gene ENSMUSG00000005370
Gene NamemutS homolog 6
SynonymsGTBP, Gtmbp, Msh6
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6357 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location87975050-87990883 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 87984460 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 214 (Y214*)
Ref Sequence ENSEMBL: ENSMUSP00000005503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005503]
Predicted Effect probably null
Transcript: ENSMUST00000005503
AA Change: Y214*
SMART Domains Protein: ENSMUSP00000005503
Gene: ENSMUSG00000005370
AA Change: Y214*

DomainStartEndE-ValueType
low complexity region 23 46 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
PWWP 90 152 9.01e-30 SMART
low complexity region 198 212 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
low complexity region 239 264 N/A INTRINSIC
low complexity region 273 291 N/A INTRINSIC
low complexity region 373 389 N/A INTRINSIC
Pfam:MutS_I 406 525 4.7e-35 PFAM
Pfam:MutS_II 536 700 1.4e-10 PFAM
MUTSd 750 1100 4.56e-86 SMART
MUTSac 1125 1319 1.68e-116 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death and are predisposed to tumor formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,930,974 M303V probably benign Het
1700061G19Rik T C 17: 56,877,591 probably null Het
3632451O06Rik A T 14: 49,773,312 S313T probably benign Het
Calcr T C 6: 3,714,710 D140G probably benign Het
Card10 T C 15: 78,799,379 E188G probably damaging Het
Cenpq T C 17: 40,924,527 E193G probably damaging Het
Cep164 G A 9: 45,770,884 L1874F probably damaging Het
Dennd3 T C 15: 73,556,472 M889T possibly damaging Het
Dnah9 T C 11: 65,874,196 K3841E probably damaging Het
Eci2 A G 13: 34,993,099 V26A possibly damaging Het
Eftud2 A T 11: 102,864,780 N200K probably damaging Het
Eml5 T A 12: 98,870,884 H357L probably damaging Het
Esam T C 9: 37,537,780 *395R probably null Het
Fam205a1 T A 4: 42,850,393 I588F probably damaging Het
Galt C T 4: 41,757,565 P246S probably benign Het
Gjb3 A T 4: 127,326,630 Y36* probably null Het
Gli2 T C 1: 118,841,959 E621G probably damaging Het
Gls T C 1: 52,219,506 D201G probably damaging Het
Gm10801 C CGTCA 2: 98,663,807 probably null Het
Gm1110 T C 9: 26,914,128 probably null Het
Gm5565 T A 5: 146,160,473 H13L possibly damaging Het
Hydin A C 8: 110,541,657 T2923P possibly damaging Het
Kank1 A T 19: 25,411,353 I797L probably benign Het
Klhdc8a A T 1: 132,303,153 Q252L probably damaging Het
Kmt5c T C 7: 4,742,205 F65S possibly damaging Het
Lix1 C T 17: 17,445,993 P138L probably benign Het
Lnpep T C 17: 17,552,914 N664S probably benign Het
Nefl A G 14: 68,084,318 E119G probably damaging Het
Nptxr C A 15: 79,794,315 R257L possibly damaging Het
Olfr726 C A 14: 50,083,989 A231S probably damaging Het
Olfr866 T A 9: 20,027,629 Q103L probably damaging Het
Oxct2b A G 4: 123,116,916 I210V probably benign Het
Plppr3 T A 10: 79,865,406 Q534L probably benign Het
Psma1 T C 7: 114,274,367 probably null Het
Rbp3 G A 14: 33,957,034 A980T probably damaging Het
Ripply2 T A 9: 87,016,278 S58R possibly damaging Het
Robo1 T C 16: 72,970,302 V454A probably benign Het
Sacs A G 14: 61,208,824 D2773G possibly damaging Het
Sirpb1b A T 3: 15,503,183 V366E possibly damaging Het
Slc5a7 T C 17: 54,287,361 I197M probably benign Het
Srgap2 T C 1: 131,355,542 Y267C probably damaging Het
Ssc4d T C 5: 135,966,096 T189A probably benign Het
Tas2r106 A G 6: 131,677,962 *309Q probably null Het
Tctex1d2 T G 16: 32,429,055 probably null Het
Theg T C 10: 79,586,955 S38G probably benign Het
Vmn2r44 T C 7: 8,370,658 M511V probably benign Het
Wdfy4 G T 14: 33,101,049 Y1364* probably null Het
Zbtb8a T C 4: 129,354,299 H393R probably benign Het
Other mutations in Msh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Msh6 APN 17 87985479 missense probably benign
IGL01834:Msh6 APN 17 87985712 missense probably damaging 1.00
IGL01904:Msh6 APN 17 87984732 missense probably benign
IGL01957:Msh6 APN 17 87985091 missense possibly damaging 0.73
IGL02117:Msh6 APN 17 87990806 unclassified probably benign
IGL02234:Msh6 APN 17 87986801 missense probably damaging 1.00
IGL02512:Msh6 APN 17 87984732 missense probably benign
IGL02651:Msh6 APN 17 87989515 missense probably damaging 1.00
IGL03381:Msh6 APN 17 87985109 missense probably damaging 1.00
medea UTSW 17 87980223 nonsense probably null
medusa UTSW 17 87988463 unclassified probably benign
PIT4449001:Msh6 UTSW 17 87986188 missense probably damaging 0.96
R0196:Msh6 UTSW 17 87980360 missense possibly damaging 0.95
R0324:Msh6 UTSW 17 87986620 nonsense probably null
R0492:Msh6 UTSW 17 87975251 missense probably benign
R0711:Msh6 UTSW 17 87986684 missense probably damaging 1.00
R1065:Msh6 UTSW 17 87988463 unclassified probably benign
R1454:Msh6 UTSW 17 87984758 missense probably benign 0.00
R1740:Msh6 UTSW 17 87985722 missense possibly damaging 0.72
R1770:Msh6 UTSW 17 87980223 nonsense probably null
R1771:Msh6 UTSW 17 87984522 missense probably benign 0.17
R1919:Msh6 UTSW 17 87985125 missense probably benign 0.01
R1926:Msh6 UTSW 17 87986225 missense probably benign
R2026:Msh6 UTSW 17 87990343 missense probably damaging 1.00
R2095:Msh6 UTSW 17 87988233 missense possibly damaging 0.93
R2097:Msh6 UTSW 17 87985416 missense probably benign 0.00
R2149:Msh6 UTSW 17 87986088 missense probably damaging 1.00
R2156:Msh6 UTSW 17 87986140 nonsense probably null
R2167:Msh6 UTSW 17 87989483 missense probably damaging 1.00
R2382:Msh6 UTSW 17 87984731 missense probably benign
R3005:Msh6 UTSW 17 87988285 missense probably benign 0.34
R3160:Msh6 UTSW 17 87985481 missense probably damaging 1.00
R3162:Msh6 UTSW 17 87985481 missense probably damaging 1.00
R3162:Msh6 UTSW 17 87985481 missense probably damaging 1.00
R3774:Msh6 UTSW 17 87986181 missense probably damaging 1.00
R3775:Msh6 UTSW 17 87986181 missense probably damaging 1.00
R4350:Msh6 UTSW 17 87984584 missense probably damaging 1.00
R4424:Msh6 UTSW 17 87990789 nonsense probably null
R4499:Msh6 UTSW 17 87980269 missense probably damaging 1.00
R4667:Msh6 UTSW 17 87984806 missense possibly damaging 0.89
R4668:Msh6 UTSW 17 87984806 missense possibly damaging 0.89
R4669:Msh6 UTSW 17 87984806 missense possibly damaging 0.89
R4849:Msh6 UTSW 17 87983519 missense possibly damaging 0.94
R5137:Msh6 UTSW 17 87980288 missense possibly damaging 0.83
R5472:Msh6 UTSW 17 87984561 missense possibly damaging 0.81
R5594:Msh6 UTSW 17 87986069 missense probably benign 0.00
R5607:Msh6 UTSW 17 87986901 missense probably damaging 1.00
R5608:Msh6 UTSW 17 87986901 missense probably damaging 1.00
R5660:Msh6 UTSW 17 87984719 missense possibly damaging 0.94
R6243:Msh6 UTSW 17 87983571 missense possibly damaging 0.69
R6279:Msh6 UTSW 17 87980249 missense probably damaging 1.00
R6399:Msh6 UTSW 17 87986891 missense probably damaging 1.00
R6453:Msh6 UTSW 17 87985739 missense probably damaging 1.00
R6646:Msh6 UTSW 17 87986442 missense possibly damaging 0.80
X0026:Msh6 UTSW 17 87986181 missense probably damaging 1.00
X0026:Msh6 UTSW 17 87990614 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGGCCTTAATACTACAGTGGTC -3'
(R):5'- AGGTCCTCACTATCGCTGTC -3'

Sequencing Primer
(F):5'- ATACTACAGTGGTCTTTAAGTGCTG -3'
(R):5'- ACTGCTCGCGTCATCACTG -3'
Posted On2018-04-27