Incidental Mutation 'R6349:Stkld1'
ID512416
Institutional Source Beutler Lab
Gene Symbol Stkld1
Ensembl Gene ENSMUSG00000049897
Gene Nameserine/threonine kinase-like domain containing 1
SynonymsLOC279029, Gm711
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6349 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location26934047-26953496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26945860 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 236 (T236A)
Ref Sequence ENSEMBL: ENSMUSP00000062967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055406] [ENSMUST00000153771]
Predicted Effect probably benign
Transcript: ENSMUST00000055406
AA Change: T236A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000062967
Gene: ENSMUSG00000049897
AA Change: T236A

DomainStartEndE-ValueType
Pfam:Pkinase 3 266 8e-35 PFAM
Pfam:Pkinase_Tyr 7 262 4.5e-27 PFAM
low complexity region 352 366 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153771
SMART Domains Protein: ENSMUSP00000121332
Gene: ENSMUSG00000049897

DomainStartEndE-ValueType
Pfam:Pkinase 4 116 2.3e-8 PFAM
Pfam:Pkinase_Tyr 6 115 4.6e-6 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012A03Rik A G 6: 32,051,660 Y9C probably benign Het
4930433I11Rik A C 7: 40,994,772 M622L possibly damaging Het
Abca8b C T 11: 109,934,718 probably null Het
Adam28 T C 14: 68,633,172 I351V probably benign Het
Adgrd1 A C 5: 129,142,539 probably null Het
Ank3 T A 10: 69,979,439 I473N probably damaging Het
Ankrd6 A T 4: 32,822,231 H179Q probably damaging Het
Ano6 A G 15: 95,966,022 R808G probably damaging Het
Anxa8 A T 14: 34,097,893 I280F probably damaging Het
Asb2 C T 12: 103,345,859 M1I probably null Het
Astn1 C T 1: 158,664,121 Q1023* probably null Het
Cast T A 13: 74,721,195 E542D probably damaging Het
Ccdc162 C T 10: 41,694,400 E30K probably damaging Het
Ccdc87 T C 19: 4,841,319 V613A probably damaging Het
Cdk13 T C 13: 17,751,719 N832S probably damaging Het
Celsr1 T A 15: 86,031,684 N696I probably damaging Het
Chd3 T C 11: 69,364,031 E161G possibly damaging Het
Cxcr4 C A 1: 128,589,277 V216F possibly damaging Het
Cyp4a10 A G 4: 115,525,358 I282V probably benign Het
Deaf1 T C 7: 141,322,950 T154A possibly damaging Het
Dido1 A T 2: 180,660,701 D1803E probably benign Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Fbxo15 A G 18: 84,964,142 I240V probably benign Het
Fcrls A G 3: 87,252,496 C484R probably damaging Het
Fech G T 18: 64,470,785 Y164* probably null Het
Fer1l5 T A 1: 36,411,274 W1175R probably damaging Het
Fgfrl1 T C 5: 108,705,506 Y241H probably damaging Het
Flvcr2 T C 12: 85,747,200 Y117H probably benign Het
Fsip2 T A 2: 82,993,072 M6383K probably benign Het
Gcc2 T A 10: 58,269,474 D141E probably benign Het
Glt1d1 A C 5: 127,706,886 R301S probably benign Het
Hars G C 18: 36,783,054 A16G probably benign Het
Hmcn2 G T 2: 31,388,373 G1696C probably damaging Het
Hydin T A 8: 110,418,459 L814* probably null Het
Izumo4 T A 10: 80,702,717 M1K probably null Het
Kdm5d T A Y: 916,847 M414K probably damaging Homo
Kif21b G A 1: 136,158,326 V812I probably damaging Het
Map3k7 A G 4: 31,988,661 D270G possibly damaging Het
Mical3 A G 6: 120,959,525 S1347P probably benign Het
Mras T A 9: 99,394,616 D67V probably damaging Het
Mtnr1b A T 9: 15,863,213 Y183* probably null Het
Muc16 A T 9: 18,657,329 L1298Q unknown Het
Myh2 A T 11: 67,193,003 I1536F probably benign Het
Olfr371 T C 8: 85,231,158 I221T possibly damaging Het
Osmr G T 15: 6,821,063 D686E probably benign Het
Pah T A 10: 87,578,969 D394E probably benign Het
Pla1a T A 16: 38,417,124 S71C probably benign Het
Proc T A 18: 32,133,433 I114L probably benign Het
Psd T G 19: 46,313,387 probably null Het
Psmb6 C T 11: 70,527,538 Q226* probably null Het
Rnpepl1 A T 1: 92,919,841 N717Y probably damaging Het
Rundc1 T C 11: 101,434,162 S565P probably benign Het
Serpinb5 T A 1: 106,881,765 S300R probably benign Het
Serpinf2 T C 11: 75,432,431 D483G probably damaging Het
Sgsm3 T C 15: 81,008,346 I291T probably benign Het
Smg6 T A 11: 75,053,774 D116E possibly damaging Het
Srfbp1 G T 18: 52,488,962 S365I probably benign Het
Susd5 T C 9: 114,095,802 V251A probably benign Het
Tcf25 A G 8: 123,391,593 Y314C probably damaging Het
Tmem210 A G 2: 25,289,036 D112G possibly damaging Het
Tubb2b A G 13: 34,127,545 Y422H probably damaging Het
Tyw1 T C 5: 130,277,031 S332P possibly damaging Het
Vmn1r29 A C 6: 58,307,427 Q44P probably damaging Het
Vrtn T C 12: 84,649,018 S181P probably damaging Het
Wdr76 T A 2: 121,534,231 Y437N possibly damaging Het
Zc3h18 C A 8: 122,408,286 probably benign Het
Zfp287 G T 11: 62,725,342 D174E probably damaging Het
Zfp800 A T 6: 28,244,602 Y121* probably null Het
Zfyve19 T A 2: 119,210,597 L57Q probably damaging Het
Other mutations in Stkld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Stkld1 APN 2 26951471 missense probably benign 0.01
IGL02183:Stkld1 APN 2 26946659 missense probably benign 0.04
IGL02393:Stkld1 APN 2 26950142 missense probably benign 0.41
IGL03136:Stkld1 APN 2 26951423 missense probably benign 0.00
IGL03261:Stkld1 APN 2 26952777 missense probably benign 0.21
R0067:Stkld1 UTSW 2 26949340 missense probably benign 0.01
R0067:Stkld1 UTSW 2 26949340 missense probably benign 0.01
R0973:Stkld1 UTSW 2 26951450 missense probably benign 0.00
R1065:Stkld1 UTSW 2 26940038 missense probably damaging 0.97
R1467:Stkld1 UTSW 2 26949395 missense probably benign 0.00
R1467:Stkld1 UTSW 2 26949395 missense probably benign 0.00
R1565:Stkld1 UTSW 2 26950090 missense probably benign 0.00
R1844:Stkld1 UTSW 2 26950103 missense probably damaging 1.00
R1871:Stkld1 UTSW 2 26937973 unclassified probably benign
R1965:Stkld1 UTSW 2 26946732 unclassified probably null
R2001:Stkld1 UTSW 2 26952747 missense probably damaging 1.00
R2308:Stkld1 UTSW 2 26952714 missense probably damaging 0.98
R2566:Stkld1 UTSW 2 26950638 missense probably damaging 1.00
R3929:Stkld1 UTSW 2 26940047 critical splice donor site probably null
R4257:Stkld1 UTSW 2 26943134 missense probably benign 0.02
R4493:Stkld1 UTSW 2 26946626 missense probably benign 0.00
R4494:Stkld1 UTSW 2 26946626 missense probably benign 0.00
R4589:Stkld1 UTSW 2 26950667 missense probably damaging 1.00
R4775:Stkld1 UTSW 2 26951745 missense probably damaging 0.99
R5601:Stkld1 UTSW 2 26952705 missense probably damaging 1.00
R5707:Stkld1 UTSW 2 26943987 missense probably damaging 1.00
R6259:Stkld1 UTSW 2 26949381 missense possibly damaging 0.70
R6306:Stkld1 UTSW 2 26943887 missense probably damaging 0.98
R6418:Stkld1 UTSW 2 26941081 missense possibly damaging 0.47
R6806:Stkld1 UTSW 2 26943910 missense probably benign 0.01
R7079:Stkld1 UTSW 2 26949347 missense probably benign 0.00
R7199:Stkld1 UTSW 2 26952714 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGCTGACTTTCCTCAGGCC -3'
(R):5'- AAGATTAGTGGCTGCCATGTAG -3'

Sequencing Primer
(F):5'- CTCTTGCTGGGCCTGATGAG -3'
(R):5'- CTGCCATGTAGTTGAGGGATAC -3'
Posted On2018-04-27