Incidental Mutation 'R6349:Zfyve19'
ID512419
Institutional Source Beutler Lab
Gene Symbol Zfyve19
Ensembl Gene ENSMUSG00000068580
Gene Namezinc finger, FYVE domain containing 19
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R6349 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location119208617-119217049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119210597 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 57 (L57Q)
Ref Sequence ENSEMBL: ENSMUSP00000099577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038439] [ENSMUST00000090174] [ENSMUST00000102519]
Predicted Effect probably benign
Transcript: ENSMUST00000038439
SMART Domains Protein: ENSMUSP00000041841
Gene: ENSMUSG00000034278

DomainStartEndE-ValueType
DnaJ 10 68 3.66e-21 SMART
coiled coil region 112 151 N/A INTRINSIC
low complexity region 172 181 N/A INTRINSIC
Pfam:RRM_1 187 243 1.8e-6 PFAM
Pfam:RRM_5 194 246 1.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000090174
AA Change: L57Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087636
Gene: ENSMUSG00000068580
AA Change: L57Q

DomainStartEndE-ValueType
FYVE 2 59 4.32e-6 SMART
RING 8 53 5.56e-1 SMART
low complexity region 167 187 N/A INTRINSIC
coiled coil region 226 260 N/A INTRINSIC
low complexity region 325 335 N/A INTRINSIC
PDB:2D8V|A 336 389 2e-35 PDB
Blast:RING 339 380 7e-21 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000102519
AA Change: L57Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099577
Gene: ENSMUSG00000068580
AA Change: L57Q

DomainStartEndE-ValueType
FYVE 2 59 4.32e-6 SMART
RING 8 53 5.56e-1 SMART
low complexity region 167 187 N/A INTRINSIC
coiled coil region 226 260 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125731
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154185
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012A03Rik A G 6: 32,051,660 Y9C probably benign Het
4930433I11Rik A C 7: 40,994,772 M622L possibly damaging Het
Abca8b C T 11: 109,934,718 probably null Het
Adam28 T C 14: 68,633,172 I351V probably benign Het
Adgrd1 A C 5: 129,142,539 probably null Het
Ank3 T A 10: 69,979,439 I473N probably damaging Het
Ankrd6 A T 4: 32,822,231 H179Q probably damaging Het
Ano6 A G 15: 95,966,022 R808G probably damaging Het
Anxa8 A T 14: 34,097,893 I280F probably damaging Het
Asb2 C T 12: 103,345,859 M1I probably null Het
Astn1 C T 1: 158,664,121 Q1023* probably null Het
Cast T A 13: 74,721,195 E542D probably damaging Het
Ccdc162 C T 10: 41,694,400 E30K probably damaging Het
Ccdc87 T C 19: 4,841,319 V613A probably damaging Het
Cdk13 T C 13: 17,751,719 N832S probably damaging Het
Celsr1 T A 15: 86,031,684 N696I probably damaging Het
Chd3 T C 11: 69,364,031 E161G possibly damaging Het
Cxcr4 C A 1: 128,589,277 V216F possibly damaging Het
Cyp4a10 A G 4: 115,525,358 I282V probably benign Het
Deaf1 T C 7: 141,322,950 T154A possibly damaging Het
Dido1 A T 2: 180,660,701 D1803E probably benign Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Fbxo15 A G 18: 84,964,142 I240V probably benign Het
Fcrls A G 3: 87,252,496 C484R probably damaging Het
Fech G T 18: 64,470,785 Y164* probably null Het
Fer1l5 T A 1: 36,411,274 W1175R probably damaging Het
Fgfrl1 T C 5: 108,705,506 Y241H probably damaging Het
Flvcr2 T C 12: 85,747,200 Y117H probably benign Het
Fsip2 T A 2: 82,993,072 M6383K probably benign Het
Gcc2 T A 10: 58,269,474 D141E probably benign Het
Glt1d1 A C 5: 127,706,886 R301S probably benign Het
Hars G C 18: 36,783,054 A16G probably benign Het
Hmcn2 G T 2: 31,388,373 G1696C probably damaging Het
Hydin T A 8: 110,418,459 L814* probably null Het
Izumo4 T A 10: 80,702,717 M1K probably null Het
Kdm5d T A Y: 916,847 M414K probably damaging Homo
Kif21b G A 1: 136,158,326 V812I probably damaging Het
Map3k7 A G 4: 31,988,661 D270G possibly damaging Het
Mical3 A G 6: 120,959,525 S1347P probably benign Het
Mras T A 9: 99,394,616 D67V probably damaging Het
Mtnr1b A T 9: 15,863,213 Y183* probably null Het
Muc16 A T 9: 18,657,329 L1298Q unknown Het
Myh2 A T 11: 67,193,003 I1536F probably benign Het
Olfr371 T C 8: 85,231,158 I221T possibly damaging Het
Osmr G T 15: 6,821,063 D686E probably benign Het
Pah T A 10: 87,578,969 D394E probably benign Het
Pla1a T A 16: 38,417,124 S71C probably benign Het
Proc T A 18: 32,133,433 I114L probably benign Het
Psd T G 19: 46,313,387 probably null Het
Psmb6 C T 11: 70,527,538 Q226* probably null Het
Rnpepl1 A T 1: 92,919,841 N717Y probably damaging Het
Rundc1 T C 11: 101,434,162 S565P probably benign Het
Serpinb5 T A 1: 106,881,765 S300R probably benign Het
Serpinf2 T C 11: 75,432,431 D483G probably damaging Het
Sgsm3 T C 15: 81,008,346 I291T probably benign Het
Smg6 T A 11: 75,053,774 D116E possibly damaging Het
Srfbp1 G T 18: 52,488,962 S365I probably benign Het
Stkld1 A G 2: 26,945,860 T236A probably benign Het
Susd5 T C 9: 114,095,802 V251A probably benign Het
Tcf25 A G 8: 123,391,593 Y314C probably damaging Het
Tmem210 A G 2: 25,289,036 D112G possibly damaging Het
Tubb2b A G 13: 34,127,545 Y422H probably damaging Het
Tyw1 T C 5: 130,277,031 S332P possibly damaging Het
Vmn1r29 A C 6: 58,307,427 Q44P probably damaging Het
Vrtn T C 12: 84,649,018 S181P probably damaging Het
Wdr76 T A 2: 121,534,231 Y437N possibly damaging Het
Zc3h18 C A 8: 122,408,286 probably benign Het
Zfp287 G T 11: 62,725,342 D174E probably damaging Het
Zfp800 A T 6: 28,244,602 Y121* probably null Het
Other mutations in Zfyve19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01078:Zfyve19 APN 2 119216500 nonsense probably null
IGL01369:Zfyve19 APN 2 119210613 splice site probably benign
IGL02387:Zfyve19 APN 2 119216426 unclassified probably benign
IGL02623:Zfyve19 APN 2 119212015 critical splice donor site probably null
IGL02904:Zfyve19 APN 2 119210472 splice site probably benign
IGL02938:Zfyve19 APN 2 119211518 missense probably benign
IGL03190:Zfyve19 APN 2 119216236 missense probably damaging 0.98
R0653:Zfyve19 UTSW 2 119211215 missense probably benign 0.00
R0835:Zfyve19 UTSW 2 119210785 missense probably benign 0.41
R1709:Zfyve19 UTSW 2 119210819 missense probably damaging 0.96
R1824:Zfyve19 UTSW 2 119211535 missense probably benign 0.00
R1938:Zfyve19 UTSW 2 119211212 missense probably benign
R3699:Zfyve19 UTSW 2 119211239 missense probably benign 0.03
R4177:Zfyve19 UTSW 2 119216212 missense possibly damaging 0.48
R4191:Zfyve19 UTSW 2 119210831 missense possibly damaging 0.84
R5492:Zfyve19 UTSW 2 119209114 start gained probably benign
R5531:Zfyve19 UTSW 2 119211946 missense probably damaging 0.99
R7199:Zfyve19 UTSW 2 119216637 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTAGAGGGTCTCAGAGAAG -3'
(R):5'- CCACTTGGAAGCATTGTCAGAAG -3'

Sequencing Primer
(F):5'- TCTCAGAGAAGAGCCATCGG -3'
(R):5'- CATTGTCAGAAGACCCTCTGGAG -3'
Posted On2018-04-27