Incidental Mutation 'R6349:Map3k7'
ID512423
Institutional Source Beutler Lab
Gene Symbol Map3k7
Ensembl Gene ENSMUSG00000028284
Gene Namemitogen-activated protein kinase kinase kinase 7
SynonymsTGF-beta activated kinase 1, Tak1, transforming growth factor beta-activated kinase 1, transforming growth factor-beta-activated kinase 1, TAK1
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_009316.1, NM_172688.3; MGI:1346877

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6349 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location31964097-32023467 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31988661 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 270 (D270G)
Ref Sequence ENSEMBL: ENSMUSP00000103819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037607] [ENSMUST00000080933] [ENSMUST00000108183] [ENSMUST00000108184]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037607
AA Change: D270G

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040307
Gene: ENSMUSG00000028284
AA Change: D270G

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Pkinase_Tyr 36 284 1.2e-61 PFAM
Pfam:Pkinase 36 285 2.8e-56 PFAM
low complexity region 361 375 N/A INTRINSIC
low complexity region 453 463 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
coiled coil region 528 593 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000080933
AA Change: D270G

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079734
Gene: ENSMUSG00000028284
AA Change: D270G

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Pkinase_Tyr 36 284 1.7e-61 PFAM
Pfam:Pkinase 36 285 8.4e-58 PFAM
low complexity region 361 375 N/A INTRINSIC
low complexity region 426 436 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
coiled coil region 501 566 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108183
AA Change: D270G

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103818
Gene: ENSMUSG00000028284
AA Change: D270G

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
S_TKc 36 284 1.6e-63 SMART
low complexity region 361 375 N/A INTRINSIC
low complexity region 426 436 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108184
AA Change: D270G

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103819
Gene: ENSMUSG00000028284
AA Change: D270G

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Pkinase_Tyr 36 284 5.6e-62 PFAM
Pfam:Pkinase 36 285 2.8e-58 PFAM
low complexity region 361 375 N/A INTRINSIC
low complexity region 453 463 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147462
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype Strain: 3664194; 3608889; 3696053
Lethality: E9-E11
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis and may have impaired vascular remodeling, edema, or an open, wavy neural tube. Mice with conditional deletion in immune cells show impaired cell development and activation. [provided by MGI curators]
Allele List at MGI

All alleles(62) : Targeted(7) Gene trapped(55)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012A03Rik A G 6: 32,051,660 Y9C probably benign Het
4930433I11Rik A C 7: 40,994,772 M622L possibly damaging Het
Abca8b C T 11: 109,934,718 probably null Het
Adam28 T C 14: 68,633,172 I351V probably benign Het
Adgrd1 A C 5: 129,142,539 probably null Het
Ank3 T A 10: 69,979,439 I473N probably damaging Het
Ankrd6 A T 4: 32,822,231 H179Q probably damaging Het
Ano6 A G 15: 95,966,022 R808G probably damaging Het
Anxa8 A T 14: 34,097,893 I280F probably damaging Het
Asb2 C T 12: 103,345,859 M1I probably null Het
Astn1 C T 1: 158,664,121 Q1023* probably null Het
Cast T A 13: 74,721,195 E542D probably damaging Het
Ccdc162 C T 10: 41,694,400 E30K probably damaging Het
Ccdc87 T C 19: 4,841,319 V613A probably damaging Het
Cdk13 T C 13: 17,751,719 N832S probably damaging Het
Celsr1 T A 15: 86,031,684 N696I probably damaging Het
Chd3 T C 11: 69,364,031 E161G possibly damaging Het
Cxcr4 C A 1: 128,589,277 V216F possibly damaging Het
Cyp4a10 A G 4: 115,525,358 I282V probably benign Het
Deaf1 T C 7: 141,322,950 T154A possibly damaging Het
Dido1 A T 2: 180,660,701 D1803E probably benign Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Fbxo15 A G 18: 84,964,142 I240V probably benign Het
Fcrls A G 3: 87,252,496 C484R probably damaging Het
Fech G T 18: 64,470,785 Y164* probably null Het
Fer1l5 T A 1: 36,411,274 W1175R probably damaging Het
Fgfrl1 T C 5: 108,705,506 Y241H probably damaging Het
Flvcr2 T C 12: 85,747,200 Y117H probably benign Het
Fsip2 T A 2: 82,993,072 M6383K probably benign Het
Gcc2 T A 10: 58,269,474 D141E probably benign Het
Glt1d1 A C 5: 127,706,886 R301S probably benign Het
Hars G C 18: 36,783,054 A16G probably benign Het
Hmcn2 G T 2: 31,388,373 G1696C probably damaging Het
Hydin T A 8: 110,418,459 L814* probably null Het
Izumo4 T A 10: 80,702,717 M1K probably null Het
Kdm5d T A Y: 916,847 M414K probably damaging Homo
Kif21b G A 1: 136,158,326 V812I probably damaging Het
Mical3 A G 6: 120,959,525 S1347P probably benign Het
Mras T A 9: 99,394,616 D67V probably damaging Het
Mtnr1b A T 9: 15,863,213 Y183* probably null Het
Muc16 A T 9: 18,657,329 L1298Q unknown Het
Myh2 A T 11: 67,193,003 I1536F probably benign Het
Olfr371 T C 8: 85,231,158 I221T possibly damaging Het
Osmr G T 15: 6,821,063 D686E probably benign Het
Pah T A 10: 87,578,969 D394E probably benign Het
Pla1a T A 16: 38,417,124 S71C probably benign Het
Proc T A 18: 32,133,433 I114L probably benign Het
Psd T G 19: 46,313,387 probably null Het
Psmb6 C T 11: 70,527,538 Q226* probably null Het
Rnpepl1 A T 1: 92,919,841 N717Y probably damaging Het
Rundc1 T C 11: 101,434,162 S565P probably benign Het
Serpinb5 T A 1: 106,881,765 S300R probably benign Het
Serpinf2 T C 11: 75,432,431 D483G probably damaging Het
Sgsm3 T C 15: 81,008,346 I291T probably benign Het
Smg6 T A 11: 75,053,774 D116E possibly damaging Het
Srfbp1 G T 18: 52,488,962 S365I probably benign Het
Stkld1 A G 2: 26,945,860 T236A probably benign Het
Susd5 T C 9: 114,095,802 V251A probably benign Het
Tcf25 A G 8: 123,391,593 Y314C probably damaging Het
Tmem210 A G 2: 25,289,036 D112G possibly damaging Het
Tubb2b A G 13: 34,127,545 Y422H probably damaging Het
Tyw1 T C 5: 130,277,031 S332P possibly damaging Het
Vmn1r29 A C 6: 58,307,427 Q44P probably damaging Het
Vrtn T C 12: 84,649,018 S181P probably damaging Het
Wdr76 T A 2: 121,534,231 Y437N possibly damaging Het
Zc3h18 C A 8: 122,408,286 probably benign Het
Zfp287 G T 11: 62,725,342 D174E probably damaging Het
Zfp800 A T 6: 28,244,602 Y121* probably null Het
Zfyve19 T A 2: 119,210,597 L57Q probably damaging Het
Other mutations in Map3k7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Map3k7 APN 4 32019539 missense probably damaging 1.00
IGL01677:Map3k7 APN 4 32017158 intron probably benign
IGL02608:Map3k7 APN 4 31981452 splice site probably benign
IGL02796:Map3k7 UTSW 4 31979692 intron probably benign
R0377:Map3k7 UTSW 4 31985731 missense probably damaging 1.00
R0498:Map3k7 UTSW 4 31974814 splice site probably benign
R1547:Map3k7 UTSW 4 31991796 missense probably benign 0.31
R2360:Map3k7 UTSW 4 31964302 missense unknown
R4709:Map3k7 UTSW 4 31985700 nonsense probably null
R4815:Map3k7 UTSW 4 31988592 missense probably damaging 0.98
R5497:Map3k7 UTSW 4 31991719 missense possibly damaging 0.56
R5813:Map3k7 UTSW 4 31964318 missense probably damaging 1.00
R7314:Map3k7 UTSW 4 31985769 nonsense probably null
X0066:Map3k7 UTSW 4 31974848 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATGTGCTACAGACTGC -3'
(R):5'- ACGCCTACTCTAACTTGAGTAAC -3'

Sequencing Primer
(F):5'- CCATGTGCTACAGACTGCAGTATAAG -3'
(R):5'- GCCTACTCTAACTTGAGTAACACTGG -3'
Posted On2018-04-27