Incidental Mutation 'R6349:Ankrd6'
ID512424
Institutional Source Beutler Lab
Gene Symbol Ankrd6
Ensembl Gene ENSMUSG00000040183
Gene Nameankyrin repeat domain 6
Synonymsdiversin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6349 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location32804035-32950841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32822231 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 179 (H179Q)
Ref Sequence ENSEMBL: ENSMUSP00000103801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035719] [ENSMUST00000084748] [ENSMUST00000084749] [ENSMUST00000084750] [ENSMUST00000108166]
Predicted Effect probably damaging
Transcript: ENSMUST00000035719
AA Change: H212Q

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041300
Gene: ENSMUSG00000040183
AA Change: H212Q

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 268 6.24e2 SMART
low complexity region 365 377 N/A INTRINSIC
coiled coil region 417 445 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 625 643 N/A INTRINSIC
coiled coil region 672 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084748
AA Change: H212Q

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081800
Gene: ENSMUSG00000040183
AA Change: H212Q

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 269 2.11e2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 382 410 N/A INTRINSIC
low complexity region 501 521 N/A INTRINSIC
low complexity region 590 608 N/A INTRINSIC
coiled coil region 637 677 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084749
AA Change: H212Q

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081801
Gene: ENSMUSG00000040183
AA Change: H212Q

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 268 6.24e2 SMART
low complexity region 365 377 N/A INTRINSIC
coiled coil region 417 445 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 625 643 N/A INTRINSIC
coiled coil region 672 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084750
AA Change: H212Q

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081802
Gene: ENSMUSG00000040183
AA Change: H212Q

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 268 6.24e2 SMART
low complexity region 365 377 N/A INTRINSIC
coiled coil region 417 445 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 625 643 N/A INTRINSIC
coiled coil region 672 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108166
AA Change: H179Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103801
Gene: ENSMUSG00000040183
AA Change: H179Q

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 3.74e0 SMART
ANK 140 169 6.12e-5 SMART
ANK 173 202 5.32e-5 SMART
low complexity region 207 227 N/A INTRINSIC
low complexity region 306 318 N/A INTRINSIC
coiled coil region 358 386 N/A INTRINSIC
low complexity region 468 491 N/A INTRINSIC
low complexity region 561 579 N/A INTRINSIC
coiled coil region 608 648 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149650
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein which is thought to be involved in the Wnt signaling pathway and embryonic axis formation. Similar genes have been found in human, rhesus macaque, and zebrafish. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display sporadic disruption of utricle hair cell polarity but normal cochlear and vestibular hair cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012A03Rik A G 6: 32,051,660 Y9C probably benign Het
4930433I11Rik A C 7: 40,994,772 M622L possibly damaging Het
Abca8b C T 11: 109,934,718 probably null Het
Adam28 T C 14: 68,633,172 I351V probably benign Het
Adgrd1 A C 5: 129,142,539 probably null Het
Ank3 T A 10: 69,979,439 I473N probably damaging Het
Ano6 A G 15: 95,966,022 R808G probably damaging Het
Anxa8 A T 14: 34,097,893 I280F probably damaging Het
Asb2 C T 12: 103,345,859 M1I probably null Het
Astn1 C T 1: 158,664,121 Q1023* probably null Het
Cast T A 13: 74,721,195 E542D probably damaging Het
Ccdc162 C T 10: 41,694,400 E30K probably damaging Het
Ccdc87 T C 19: 4,841,319 V613A probably damaging Het
Cdk13 T C 13: 17,751,719 N832S probably damaging Het
Celsr1 T A 15: 86,031,684 N696I probably damaging Het
Chd3 T C 11: 69,364,031 E161G possibly damaging Het
Cxcr4 C A 1: 128,589,277 V216F possibly damaging Het
Cyp4a10 A G 4: 115,525,358 I282V probably benign Het
Deaf1 T C 7: 141,322,950 T154A possibly damaging Het
Dido1 A T 2: 180,660,701 D1803E probably benign Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Fbxo15 A G 18: 84,964,142 I240V probably benign Het
Fcrls A G 3: 87,252,496 C484R probably damaging Het
Fech G T 18: 64,470,785 Y164* probably null Het
Fer1l5 T A 1: 36,411,274 W1175R probably damaging Het
Fgfrl1 T C 5: 108,705,506 Y241H probably damaging Het
Flvcr2 T C 12: 85,747,200 Y117H probably benign Het
Fsip2 T A 2: 82,993,072 M6383K probably benign Het
Gcc2 T A 10: 58,269,474 D141E probably benign Het
Glt1d1 A C 5: 127,706,886 R301S probably benign Het
Hars G C 18: 36,783,054 A16G probably benign Het
Hmcn2 G T 2: 31,388,373 G1696C probably damaging Het
Hydin T A 8: 110,418,459 L814* probably null Het
Izumo4 T A 10: 80,702,717 M1K probably null Het
Kdm5d T A Y: 916,847 M414K probably damaging Homo
Kif21b G A 1: 136,158,326 V812I probably damaging Het
Map3k7 A G 4: 31,988,661 D270G possibly damaging Het
Mical3 A G 6: 120,959,525 S1347P probably benign Het
Mras T A 9: 99,394,616 D67V probably damaging Het
Mtnr1b A T 9: 15,863,213 Y183* probably null Het
Muc16 A T 9: 18,657,329 L1298Q unknown Het
Myh2 A T 11: 67,193,003 I1536F probably benign Het
Olfr371 T C 8: 85,231,158 I221T possibly damaging Het
Osmr G T 15: 6,821,063 D686E probably benign Het
Pah T A 10: 87,578,969 D394E probably benign Het
Pla1a T A 16: 38,417,124 S71C probably benign Het
Proc T A 18: 32,133,433 I114L probably benign Het
Psd T G 19: 46,313,387 probably null Het
Psmb6 C T 11: 70,527,538 Q226* probably null Het
Rnpepl1 A T 1: 92,919,841 N717Y probably damaging Het
Rundc1 T C 11: 101,434,162 S565P probably benign Het
Serpinb5 T A 1: 106,881,765 S300R probably benign Het
Serpinf2 T C 11: 75,432,431 D483G probably damaging Het
Sgsm3 T C 15: 81,008,346 I291T probably benign Het
Smg6 T A 11: 75,053,774 D116E possibly damaging Het
Srfbp1 G T 18: 52,488,962 S365I probably benign Het
Stkld1 A G 2: 26,945,860 T236A probably benign Het
Susd5 T C 9: 114,095,802 V251A probably benign Het
Tcf25 A G 8: 123,391,593 Y314C probably damaging Het
Tmem210 A G 2: 25,289,036 D112G possibly damaging Het
Tubb2b A G 13: 34,127,545 Y422H probably damaging Het
Tyw1 T C 5: 130,277,031 S332P possibly damaging Het
Vmn1r29 A C 6: 58,307,427 Q44P probably damaging Het
Vrtn T C 12: 84,649,018 S181P probably damaging Het
Wdr76 T A 2: 121,534,231 Y437N possibly damaging Het
Zc3h18 C A 8: 122,408,286 probably benign Het
Zfp287 G T 11: 62,725,342 D174E probably damaging Het
Zfp800 A T 6: 28,244,602 Y121* probably null Het
Zfyve19 T A 2: 119,210,597 L57Q probably damaging Het
Other mutations in Ankrd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02489:Ankrd6 APN 4 32810298 missense probably damaging 1.00
IGL03247:Ankrd6 APN 4 32860441 start codon destroyed possibly damaging 0.76
IGL03382:Ankrd6 APN 4 32808771 missense probably damaging 1.00
R0360:Ankrd6 UTSW 4 32836424 missense probably damaging 1.00
R0711:Ankrd6 UTSW 4 32815326 missense probably damaging 1.00
R1074:Ankrd6 UTSW 4 32822232 missense probably damaging 1.00
R1075:Ankrd6 UTSW 4 32822232 missense probably damaging 1.00
R1498:Ankrd6 UTSW 4 32810289 missense probably benign 0.17
R1719:Ankrd6 UTSW 4 32828774 missense probably damaging 1.00
R1823:Ankrd6 UTSW 4 32824427 missense probably damaging 1.00
R2889:Ankrd6 UTSW 4 32818704 missense probably damaging 0.99
R2897:Ankrd6 UTSW 4 32860438 missense probably damaging 0.98
R3815:Ankrd6 UTSW 4 32806206 missense probably benign 0.39
R3836:Ankrd6 UTSW 4 32817531 missense probably damaging 1.00
R4127:Ankrd6 UTSW 4 32822241 missense probably damaging 1.00
R4994:Ankrd6 UTSW 4 32860387 missense probably damaging 0.99
R5250:Ankrd6 UTSW 4 32860335 missense probably damaging 1.00
R5291:Ankrd6 UTSW 4 32823446 missense probably damaging 1.00
R5335:Ankrd6 UTSW 4 32818651 missense probably damaging 1.00
R5948:Ankrd6 UTSW 4 32817075 missense possibly damaging 0.91
R6336:Ankrd6 UTSW 4 32860411 missense probably damaging 1.00
R6345:Ankrd6 UTSW 4 32810266 missense probably damaging 1.00
R6516:Ankrd6 UTSW 4 32836427 missense probably damaging 1.00
R6902:Ankrd6 UTSW 4 32806419 missense probably damaging 1.00
R6902:Ankrd6 UTSW 4 32806420 missense probably damaging 1.00
R6999:Ankrd6 UTSW 4 32823459 missense probably benign
R7044:Ankrd6 UTSW 4 32815260 missense possibly damaging 0.93
R7307:Ankrd6 UTSW 4 32816949 missense possibly damaging 0.92
R7394:Ankrd6 UTSW 4 32821298 missense probably damaging 0.99
X0064:Ankrd6 UTSW 4 32806435 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTGTTAACTCCTGGGGCTGC -3'
(R):5'- GTATGGTGAACGCATTGACC -3'

Sequencing Primer
(F):5'- AGCTGGCCCAGTTCAGATGAG -3'
(R):5'- GTGAACGCATTGACCATTCAG -3'
Posted On2018-04-27