Incidental Mutation 'R6349:Olfr371'
ID512436
Institutional Source Beutler Lab
Gene Symbol Olfr371
Ensembl Gene ENSMUSG00000051952
Gene Nameolfactory receptor 371
SynonymsGA_x6K02T2NUPS-13298842-13299780, MOR141-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6349 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location85225988-85231509 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85231158 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 221 (I221T)
Ref Sequence ENSEMBL: ENSMUSP00000151714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070849] [ENSMUST00000218663]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070849
AA Change: I221T

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077921
Gene: ENSMUSG00000051952
AA Change: I221T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.1e-55 PFAM
Pfam:7TM_GPCR_Srx 32 305 2.2e-6 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.2e-8 PFAM
Pfam:7tm_1 41 290 9.2e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000218663
AA Change: I221T

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012A03Rik A G 6: 32,051,660 Y9C probably benign Het
4930433I11Rik A C 7: 40,994,772 M622L possibly damaging Het
Abca8b C T 11: 109,934,718 probably null Het
Adam28 T C 14: 68,633,172 I351V probably benign Het
Adgrd1 A C 5: 129,142,539 probably null Het
Ank3 T A 10: 69,979,439 I473N probably damaging Het
Ankrd6 A T 4: 32,822,231 H179Q probably damaging Het
Ano6 A G 15: 95,966,022 R808G probably damaging Het
Anxa8 A T 14: 34,097,893 I280F probably damaging Het
Asb2 C T 12: 103,345,859 M1I probably null Het
Astn1 C T 1: 158,664,121 Q1023* probably null Het
Cast T A 13: 74,721,195 E542D probably damaging Het
Ccdc162 C T 10: 41,694,400 E30K probably damaging Het
Ccdc87 T C 19: 4,841,319 V613A probably damaging Het
Cdk13 T C 13: 17,751,719 N832S probably damaging Het
Celsr1 T A 15: 86,031,684 N696I probably damaging Het
Chd3 T C 11: 69,364,031 E161G possibly damaging Het
Cxcr4 C A 1: 128,589,277 V216F possibly damaging Het
Cyp4a10 A G 4: 115,525,358 I282V probably benign Het
Deaf1 T C 7: 141,322,950 T154A possibly damaging Het
Dido1 A T 2: 180,660,701 D1803E probably benign Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Fbxo15 A G 18: 84,964,142 I240V probably benign Het
Fcrls A G 3: 87,252,496 C484R probably damaging Het
Fech G T 18: 64,470,785 Y164* probably null Het
Fer1l5 T A 1: 36,411,274 W1175R probably damaging Het
Fgfrl1 T C 5: 108,705,506 Y241H probably damaging Het
Flvcr2 T C 12: 85,747,200 Y117H probably benign Het
Fsip2 T A 2: 82,993,072 M6383K probably benign Het
Gcc2 T A 10: 58,269,474 D141E probably benign Het
Glt1d1 A C 5: 127,706,886 R301S probably benign Het
Hars G C 18: 36,783,054 A16G probably benign Het
Hmcn2 G T 2: 31,388,373 G1696C probably damaging Het
Hydin T A 8: 110,418,459 L814* probably null Het
Izumo4 T A 10: 80,702,717 M1K probably null Het
Kdm5d T A Y: 916,847 M414K probably damaging Homo
Kif21b G A 1: 136,158,326 V812I probably damaging Het
Map3k7 A G 4: 31,988,661 D270G possibly damaging Het
Mical3 A G 6: 120,959,525 S1347P probably benign Het
Mras T A 9: 99,394,616 D67V probably damaging Het
Mtnr1b A T 9: 15,863,213 Y183* probably null Het
Muc16 A T 9: 18,657,329 L1298Q unknown Het
Myh2 A T 11: 67,193,003 I1536F probably benign Het
Osmr G T 15: 6,821,063 D686E probably benign Het
Pah T A 10: 87,578,969 D394E probably benign Het
Pla1a T A 16: 38,417,124 S71C probably benign Het
Proc T A 18: 32,133,433 I114L probably benign Het
Psd T G 19: 46,313,387 probably null Het
Psmb6 C T 11: 70,527,538 Q226* probably null Het
Rnpepl1 A T 1: 92,919,841 N717Y probably damaging Het
Rundc1 T C 11: 101,434,162 S565P probably benign Het
Serpinb5 T A 1: 106,881,765 S300R probably benign Het
Serpinf2 T C 11: 75,432,431 D483G probably damaging Het
Sgsm3 T C 15: 81,008,346 I291T probably benign Het
Smg6 T A 11: 75,053,774 D116E possibly damaging Het
Srfbp1 G T 18: 52,488,962 S365I probably benign Het
Stkld1 A G 2: 26,945,860 T236A probably benign Het
Susd5 T C 9: 114,095,802 V251A probably benign Het
Tcf25 A G 8: 123,391,593 Y314C probably damaging Het
Tmem210 A G 2: 25,289,036 D112G possibly damaging Het
Tubb2b A G 13: 34,127,545 Y422H probably damaging Het
Tyw1 T C 5: 130,277,031 S332P possibly damaging Het
Vmn1r29 A C 6: 58,307,427 Q44P probably damaging Het
Vrtn T C 12: 84,649,018 S181P probably damaging Het
Wdr76 T A 2: 121,534,231 Y437N possibly damaging Het
Zc3h18 C A 8: 122,408,286 probably benign Het
Zfp287 G T 11: 62,725,342 D174E probably damaging Het
Zfp800 A T 6: 28,244,602 Y121* probably null Het
Zfyve19 T A 2: 119,210,597 L57Q probably damaging Het
Other mutations in Olfr371
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Olfr371 APN 8 85231184 missense probably benign 0.14
IGL01380:Olfr371 APN 8 85231329 missense possibly damaging 0.95
IGL01380:Olfr371 APN 8 85231146 missense probably damaging 0.99
IGL01680:Olfr371 APN 8 85230679 missense probably benign
IGL01880:Olfr371 APN 8 85231083 missense probably benign 0.00
IGL02194:Olfr371 APN 8 85230633 missense possibly damaging 0.82
IGL02416:Olfr371 APN 8 85231033 nonsense probably null
IGL02494:Olfr371 APN 8 85230683 missense possibly damaging 0.95
IGL03072:Olfr371 APN 8 85230510 missense probably benign 0.08
IGL03130:Olfr371 APN 8 85230629 missense possibly damaging 0.93
R0017:Olfr371 UTSW 8 85231077 missense probably benign 0.25
R1157:Olfr371 UTSW 8 85231260 missense probably damaging 0.98
R1165:Olfr371 UTSW 8 85230771 missense probably damaging 0.98
R1730:Olfr371 UTSW 8 85230848 missense probably benign 0.16
R2017:Olfr371 UTSW 8 85230744 missense possibly damaging 0.91
R2426:Olfr371 UTSW 8 85231064 missense probably damaging 0.97
R4447:Olfr371 UTSW 8 85231366 nonsense probably null
R4703:Olfr371 UTSW 8 85230608 missense possibly damaging 0.95
R4797:Olfr371 UTSW 8 85230938 missense probably benign
R5029:Olfr371 UTSW 8 85231206 missense probably benign 0.00
R5173:Olfr371 UTSW 8 85230576 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGCATACTTGGAGCCCTGC -3'
(R):5'- CATGGGAGTGACCACAGTGTAC -3'

Sequencing Primer
(F):5'- CCTGAGAGTTTAACTGCACTGAGAC -3'
(R):5'- TGACCACAGTGTACAGAACAG -3'
Posted On2018-04-27