Incidental Mutation 'R6349:Izumo4'
ID512448
Institutional Source Beutler Lab
Gene Symbol Izumo4
Ensembl Gene ENSMUSG00000055862
Gene NameIZUMO family member 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6349 (G1)
Quality Score89.0077
Status Not validated
Chromosome10
Chromosomal Location80702184-80705373 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 80702717 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000151397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003438] [ENSMUST00000020420] [ENSMUST00000218090] [ENSMUST00000218184]
Predicted Effect probably benign
Transcript: ENSMUST00000003438
SMART Domains Protein: ENSMUSP00000003438
Gene: ENSMUSG00000003348

DomainStartEndE-ValueType
Mob1_phocein 34 208 6.02e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020420
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000095426
SMART Domains Protein: ENSMUSP00000093076
Gene: ENSMUSG00000055862

DomainStartEndE-ValueType
Pfam:IZUMO 26 167 1.1e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218058
Predicted Effect probably benign
Transcript: ENSMUST00000218090
Predicted Effect probably null
Transcript: ENSMUST00000218184
AA Change: M1K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000218330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219987
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012A03Rik A G 6: 32,051,660 Y9C probably benign Het
4930433I11Rik A C 7: 40,994,772 M622L possibly damaging Het
Abca8b C T 11: 109,934,718 probably null Het
Adam28 T C 14: 68,633,172 I351V probably benign Het
Adgrd1 A C 5: 129,142,539 probably null Het
Ank3 T A 10: 69,979,439 I473N probably damaging Het
Ankrd6 A T 4: 32,822,231 H179Q probably damaging Het
Ano6 A G 15: 95,966,022 R808G probably damaging Het
Anxa8 A T 14: 34,097,893 I280F probably damaging Het
Asb2 C T 12: 103,345,859 M1I probably null Het
Astn1 C T 1: 158,664,121 Q1023* probably null Het
Cast T A 13: 74,721,195 E542D probably damaging Het
Ccdc162 C T 10: 41,694,400 E30K probably damaging Het
Ccdc87 T C 19: 4,841,319 V613A probably damaging Het
Cdk13 T C 13: 17,751,719 N832S probably damaging Het
Celsr1 T A 15: 86,031,684 N696I probably damaging Het
Chd3 T C 11: 69,364,031 E161G possibly damaging Het
Cxcr4 C A 1: 128,589,277 V216F possibly damaging Het
Cyp4a10 A G 4: 115,525,358 I282V probably benign Het
Deaf1 T C 7: 141,322,950 T154A possibly damaging Het
Dido1 A T 2: 180,660,701 D1803E probably benign Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Fbxo15 A G 18: 84,964,142 I240V probably benign Het
Fcrls A G 3: 87,252,496 C484R probably damaging Het
Fech G T 18: 64,470,785 Y164* probably null Het
Fer1l5 T A 1: 36,411,274 W1175R probably damaging Het
Fgfrl1 T C 5: 108,705,506 Y241H probably damaging Het
Flvcr2 T C 12: 85,747,200 Y117H probably benign Het
Fsip2 T A 2: 82,993,072 M6383K probably benign Het
Gcc2 T A 10: 58,269,474 D141E probably benign Het
Glt1d1 A C 5: 127,706,886 R301S probably benign Het
Hars G C 18: 36,783,054 A16G probably benign Het
Hmcn2 G T 2: 31,388,373 G1696C probably damaging Het
Hydin T A 8: 110,418,459 L814* probably null Het
Kdm5d T A Y: 916,847 M414K probably damaging Homo
Kif21b G A 1: 136,158,326 V812I probably damaging Het
Map3k7 A G 4: 31,988,661 D270G possibly damaging Het
Mical3 A G 6: 120,959,525 S1347P probably benign Het
Mras T A 9: 99,394,616 D67V probably damaging Het
Mtnr1b A T 9: 15,863,213 Y183* probably null Het
Muc16 A T 9: 18,657,329 L1298Q unknown Het
Myh2 A T 11: 67,193,003 I1536F probably benign Het
Olfr371 T C 8: 85,231,158 I221T possibly damaging Het
Osmr G T 15: 6,821,063 D686E probably benign Het
Pah T A 10: 87,578,969 D394E probably benign Het
Pla1a T A 16: 38,417,124 S71C probably benign Het
Proc T A 18: 32,133,433 I114L probably benign Het
Psd T G 19: 46,313,387 probably null Het
Psmb6 C T 11: 70,527,538 Q226* probably null Het
Rnpepl1 A T 1: 92,919,841 N717Y probably damaging Het
Rundc1 T C 11: 101,434,162 S565P probably benign Het
Serpinb5 T A 1: 106,881,765 S300R probably benign Het
Serpinf2 T C 11: 75,432,431 D483G probably damaging Het
Sgsm3 T C 15: 81,008,346 I291T probably benign Het
Smg6 T A 11: 75,053,774 D116E possibly damaging Het
Srfbp1 G T 18: 52,488,962 S365I probably benign Het
Stkld1 A G 2: 26,945,860 T236A probably benign Het
Susd5 T C 9: 114,095,802 V251A probably benign Het
Tcf25 A G 8: 123,391,593 Y314C probably damaging Het
Tmem210 A G 2: 25,289,036 D112G possibly damaging Het
Tubb2b A G 13: 34,127,545 Y422H probably damaging Het
Tyw1 T C 5: 130,277,031 S332P possibly damaging Het
Vmn1r29 A C 6: 58,307,427 Q44P probably damaging Het
Vrtn T C 12: 84,649,018 S181P probably damaging Het
Wdr76 T A 2: 121,534,231 Y437N possibly damaging Het
Zc3h18 C A 8: 122,408,286 probably benign Het
Zfp287 G T 11: 62,725,342 D174E probably damaging Het
Zfp800 A T 6: 28,244,602 Y121* probably null Het
Zfyve19 T A 2: 119,210,597 L57Q probably damaging Het
Other mutations in Izumo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02850:Izumo4 APN 10 80704198 unclassified probably benign
IGL03019:Izumo4 APN 10 80703846 unclassified probably benign
IGL03391:Izumo4 APN 10 80705113 missense probably damaging 0.97
F5770:Izumo4 UTSW 10 80703891 missense probably benign 0.02
IGL02835:Izumo4 UTSW 10 80705125 missense probably benign
R0304:Izumo4 UTSW 10 80702936 missense probably damaging 1.00
R0377:Izumo4 UTSW 10 80702840 missense probably damaging 1.00
R0411:Izumo4 UTSW 10 80703084 missense probably damaging 0.99
R0498:Izumo4 UTSW 10 80704196 critical splice donor site probably null
R1822:Izumo4 UTSW 10 80703895 missense probably damaging 1.00
R1870:Izumo4 UTSW 10 80703735 missense probably damaging 1.00
R1977:Izumo4 UTSW 10 80703121 missense probably damaging 1.00
R2237:Izumo4 UTSW 10 80702830 missense probably damaging 1.00
R5288:Izumo4 UTSW 10 80702805 nonsense probably null
R5543:Izumo4 UTSW 10 80702834 missense probably damaging 1.00
R5587:Izumo4 UTSW 10 80703220 missense probably damaging 1.00
R6199:Izumo4 UTSW 10 80702873 missense probably damaging 1.00
R6222:Izumo4 UTSW 10 80703051 missense probably damaging 1.00
V7580:Izumo4 UTSW 10 80703891 missense probably benign 0.02
V7581:Izumo4 UTSW 10 80703891 missense probably benign 0.02
V7582:Izumo4 UTSW 10 80703891 missense probably benign 0.02
V7583:Izumo4 UTSW 10 80703891 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGGACAGGAGTCTAATCGG -3'
(R):5'- TCGTGTTCTGGATCCAATCGG -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- TCCAATCGGAGAGCAGCATC -3'
Posted On2018-04-27