Incidental Mutation 'R6349:Smg6'
ID512454
Institutional Source Beutler Lab
Gene Symbol Smg6
Ensembl Gene ENSMUSG00000038290
Gene NameSmg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_001002764.1; Ensembl: ENSMUST00000045281

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6349 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location74925823-75164448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75053774 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 116 (D116E)
Ref Sequence ENSEMBL: ENSMUSP00000120060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045281] [ENSMUST00000140197]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045281
AA Change: D1055E

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000043555
Gene: ENSMUSG00000038290
AA Change: D1055E

DomainStartEndE-ValueType
internal_repeat_1 42 99 7.68e-6 PROSPERO
internal_repeat_1 135 188 7.68e-6 PROSPERO
low complexity region 212 227 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 417 426 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
coiled coil region 574 600 N/A INTRINSIC
Pfam:EST1 637 742 1.8e-18 PFAM
Pfam:EST1_DNA_bind 750 1106 1.6e-78 PFAM
coiled coil region 1197 1234 N/A INTRINSIC
PINc 1245 1396 2.85e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130145
SMART Domains Protein: ENSMUSP00000120229
Gene: ENSMUSG00000038290

DomainStartEndE-ValueType
coiled coil region 35 61 N/A INTRINSIC
Pfam:EST1 99 204 1.3e-19 PFAM
Pfam:EST1_DNA_bind 212 339 7.3e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000140197
AA Change: D116E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120060
Gene: ENSMUSG00000038290
AA Change: D116E

DomainStartEndE-ValueType
Pfam:EST1_DNA_bind 2 167 4.9e-25 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the telomerase ribonucleoprotein complex responsible for the replication and maintenance of chromosome ends. The encoded protein also plays a role in the nonsense-mediated mRNA decay (NMD) pathway, providing the endonuclease activity near the premature translation termination codon that is needed to initiate NMD. Alternatively spliced transcript variants encoding distinct protein isoforms have been described. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygosity for insertion of a transgene into intron 6 of the gene results in embryonic lethality. Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice homozygous for a conditional allele activated in embryonic stem cells exhibit defective telomere maintenance and NMD. [provided by MGI curators]
Allele List at MGI

All alleles(52) : Gene trapped(52)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012A03Rik A G 6: 32,051,660 Y9C probably benign Het
4930433I11Rik A C 7: 40,994,772 M622L possibly damaging Het
Abca8b C T 11: 109,934,718 probably null Het
Adam28 T C 14: 68,633,172 I351V probably benign Het
Adgrd1 A C 5: 129,142,539 probably null Het
Ank3 T A 10: 69,979,439 I473N probably damaging Het
Ankrd6 A T 4: 32,822,231 H179Q probably damaging Het
Ano6 A G 15: 95,966,022 R808G probably damaging Het
Anxa8 A T 14: 34,097,893 I280F probably damaging Het
Asb2 C T 12: 103,345,859 M1I probably null Het
Astn1 C T 1: 158,664,121 Q1023* probably null Het
Cast T A 13: 74,721,195 E542D probably damaging Het
Ccdc162 C T 10: 41,694,400 E30K probably damaging Het
Ccdc87 T C 19: 4,841,319 V613A probably damaging Het
Cdk13 T C 13: 17,751,719 N832S probably damaging Het
Celsr1 T A 15: 86,031,684 N696I probably damaging Het
Chd3 T C 11: 69,364,031 E161G possibly damaging Het
Cxcr4 C A 1: 128,589,277 V216F possibly damaging Het
Cyp4a10 A G 4: 115,525,358 I282V probably benign Het
Deaf1 T C 7: 141,322,950 T154A possibly damaging Het
Dido1 A T 2: 180,660,701 D1803E probably benign Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Fbxo15 A G 18: 84,964,142 I240V probably benign Het
Fcrls A G 3: 87,252,496 C484R probably damaging Het
Fech G T 18: 64,470,785 Y164* probably null Het
Fer1l5 T A 1: 36,411,274 W1175R probably damaging Het
Fgfrl1 T C 5: 108,705,506 Y241H probably damaging Het
Flvcr2 T C 12: 85,747,200 Y117H probably benign Het
Fsip2 T A 2: 82,993,072 M6383K probably benign Het
Gcc2 T A 10: 58,269,474 D141E probably benign Het
Glt1d1 A C 5: 127,706,886 R301S probably benign Het
Hars G C 18: 36,783,054 A16G probably benign Het
Hmcn2 G T 2: 31,388,373 G1696C probably damaging Het
Hydin T A 8: 110,418,459 L814* probably null Het
Izumo4 T A 10: 80,702,717 M1K probably null Het
Kdm5d T A Y: 916,847 M414K probably damaging Homo
Kif21b G A 1: 136,158,326 V812I probably damaging Het
Map3k7 A G 4: 31,988,661 D270G possibly damaging Het
Mical3 A G 6: 120,959,525 S1347P probably benign Het
Mras T A 9: 99,394,616 D67V probably damaging Het
Mtnr1b A T 9: 15,863,213 Y183* probably null Het
Muc16 A T 9: 18,657,329 L1298Q unknown Het
Myh2 A T 11: 67,193,003 I1536F probably benign Het
Olfr371 T C 8: 85,231,158 I221T possibly damaging Het
Osmr G T 15: 6,821,063 D686E probably benign Het
Pah T A 10: 87,578,969 D394E probably benign Het
Pla1a T A 16: 38,417,124 S71C probably benign Het
Proc T A 18: 32,133,433 I114L probably benign Het
Psd T G 19: 46,313,387 probably null Het
Psmb6 C T 11: 70,527,538 Q226* probably null Het
Rnpepl1 A T 1: 92,919,841 N717Y probably damaging Het
Rundc1 T C 11: 101,434,162 S565P probably benign Het
Serpinb5 T A 1: 106,881,765 S300R probably benign Het
Serpinf2 T C 11: 75,432,431 D483G probably damaging Het
Sgsm3 T C 15: 81,008,346 I291T probably benign Het
Srfbp1 G T 18: 52,488,962 S365I probably benign Het
Stkld1 A G 2: 26,945,860 T236A probably benign Het
Susd5 T C 9: 114,095,802 V251A probably benign Het
Tcf25 A G 8: 123,391,593 Y314C probably damaging Het
Tmem210 A G 2: 25,289,036 D112G possibly damaging Het
Tubb2b A G 13: 34,127,545 Y422H probably damaging Het
Tyw1 T C 5: 130,277,031 S332P possibly damaging Het
Vmn1r29 A C 6: 58,307,427 Q44P probably damaging Het
Vrtn T C 12: 84,649,018 S181P probably damaging Het
Wdr76 T A 2: 121,534,231 Y437N possibly damaging Het
Zc3h18 C A 8: 122,408,286 probably benign Het
Zfp287 G T 11: 62,725,342 D174E probably damaging Het
Zfp800 A T 6: 28,244,602 Y121* probably null Het
Zfyve19 T A 2: 119,210,597 L57Q probably damaging Het
Other mutations in Smg6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Smg6 APN 11 74929148 missense probably benign
IGL01146:Smg6 APN 11 74930428 nonsense probably null
IGL01505:Smg6 APN 11 75156291 missense probably damaging 1.00
IGL01541:Smg6 APN 11 74925944 missense probably benign 0.43
IGL01636:Smg6 APN 11 74935103 critical splice donor site probably null
IGL02379:Smg6 APN 11 75053925 missense probably damaging 1.00
IGL02794:Smg6 APN 11 75053934 missense probably damaging 0.99
IGL02964:Smg6 APN 11 74930750 critical splice donor site probably null
IGL03057:Smg6 APN 11 74935434 nonsense probably null
1mM(1):Smg6 UTSW 11 74934989 splice site probably benign
IGL03097:Smg6 UTSW 11 74932426 missense probably damaging 1.00
PIT4802001:Smg6 UTSW 11 75156165 missense probably damaging 0.96
R0269:Smg6 UTSW 11 75162931 missense probably benign
R0344:Smg6 UTSW 11 74929821 missense probably damaging 1.00
R0437:Smg6 UTSW 11 74929701 missense probably damaging 1.00
R0452:Smg6 UTSW 11 74930213 missense probably benign
R0511:Smg6 UTSW 11 74929058 missense probably damaging 1.00
R0617:Smg6 UTSW 11 75162931 missense probably benign
R0737:Smg6 UTSW 11 75159836 missense probably damaging 1.00
R1715:Smg6 UTSW 11 74929430 missense probably benign
R1780:Smg6 UTSW 11 74946116 missense probably damaging 1.00
R1927:Smg6 UTSW 11 75142848 missense probably damaging 1.00
R2073:Smg6 UTSW 11 74930294 missense probably damaging 1.00
R2171:Smg6 UTSW 11 75038646 missense probably damaging 1.00
R2513:Smg6 UTSW 11 74929676 missense probably damaging 1.00
R3943:Smg6 UTSW 11 74929541 missense probably damaging 1.00
R3944:Smg6 UTSW 11 74929541 missense probably damaging 1.00
R4275:Smg6 UTSW 11 74993874 intron probably benign
R4369:Smg6 UTSW 11 74932443 nonsense probably null
R4452:Smg6 UTSW 11 74990141 missense probably benign 0.14
R4864:Smg6 UTSW 11 74930162 missense possibly damaging 0.89
R4885:Smg6 UTSW 11 75041918 missense probably damaging 1.00
R5043:Smg6 UTSW 11 74929895 missense possibly damaging 0.86
R5189:Smg6 UTSW 11 75041996 missense probably damaging 1.00
R5378:Smg6 UTSW 11 75041994 missense possibly damaging 0.61
R5518:Smg6 UTSW 11 75053898 missense probably damaging 0.99
R5725:Smg6 UTSW 11 74930613 missense probably benign 0.45
R5746:Smg6 UTSW 11 75139287 missense probably damaging 1.00
R6151:Smg6 UTSW 11 75156207 missense probably damaging 0.96
R6319:Smg6 UTSW 11 75156222 missense probably damaging 1.00
R6500:Smg6 UTSW 11 74930505 missense possibly damaging 0.74
R6619:Smg6 UTSW 11 74932453 critical splice donor site probably null
R6820:Smg6 UTSW 11 75041964 missense probably damaging 0.99
R6923:Smg6 UTSW 11 74929343 missense possibly damaging 0.50
X0018:Smg6 UTSW 11 74929986 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- ACATAGATGGTAGCTATGGGCAC -3'
(R):5'- AAGGGATGTTTGGCCTGCAG -3'

Sequencing Primer
(F):5'- AGCTATGGGCACAACTTAATATTAC -3'
(R):5'- CGAGGTTTTCTCCACGTAGCAG -3'
Posted On2018-04-27