Incidental Mutation 'R6362:Olfr1105'
ID512488
Institutional Source Beutler Lab
Gene Symbol Olfr1105
Ensembl Gene ENSMUSG00000075165
Gene Nameolfactory receptor 1105
SynonymsMOR172-7, MOR0-6P, GA_x6K02T2Q125-48521031-48520093
MMRRC Submission
Accession Numbers

Genbank: NM_001011825; MGI: 3030939

Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6362 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87031260-87036531 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87033289 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 311 (A311T)
Ref Sequence ENSEMBL: ENSMUSP00000149148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099868] [ENSMUST00000215978]
Predicted Effect probably benign
Transcript: ENSMUST00000099868
AA Change: A311T

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097453
Gene: ENSMUSG00000075165
AA Change: A311T

DomainStartEndE-ValueType
Pfam:7tm_4 30 308 5.2e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 305 5.5e-6 PFAM
Pfam:7tm_1 41 308 5.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215978
AA Change: A311T

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T G 2: 173,528,174 probably null Het
Aldh5a1 T G 13: 24,918,550 D310A probably benign Het
Als2cl T A 9: 110,895,446 probably null Het
Amacr C A 15: 10,984,805 R170S probably damaging Het
Brwd1 C T 16: 96,002,307 R2221Q probably damaging Het
Cacna1g A T 11: 94,439,707 probably null Het
Cd3d G A 9: 44,986,291 D157N probably damaging Het
Cep131 T C 11: 120,064,690 D1043G probably damaging Het
Cit A G 5: 115,886,676 D326G probably benign Het
Col16a1 G C 4: 130,066,190 G370R unknown Het
Col6a3 T A 1: 90,810,563 Y1078F probably damaging Het
Colgalt2 A C 1: 152,471,798 Y161S probably damaging Het
Cyp2j13 A G 4: 96,071,695 Y75H probably damaging Het
Daxx G A 17: 33,911,364 V118I probably damaging Het
Dennd5a G T 7: 109,934,265 C75* probably null Het
Diaph3 A G 14: 86,772,130 L1071P probably damaging Het
Disp3 A G 4: 148,254,308 L802P possibly damaging Het
Dmc1 A G 15: 79,588,823 V141A probably benign Het
Dsc2 A T 18: 20,035,463 Y45* probably null Het
Dspp A G 5: 104,176,034 I348V probably benign Het
Epb42 C A 2: 121,025,779 C428F possibly damaging Het
Fam227a G T 15: 79,643,350 P100Q possibly damaging Het
Fer1l4 C T 2: 156,048,250 V252I probably benign Het
Fhod1 C A 8: 105,331,641 probably null Het
Fhod3 G T 18: 24,754,255 A68S probably benign Het
Gatm T C 2: 122,598,196 D328G probably benign Het
Gm13103 A G 4: 143,852,865 Y340C probably damaging Het
Gm6401 G T 14: 41,967,770 H44N probably benign Het
Gm884 G C 11: 103,620,652 N163K unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpr84 G A 15: 103,308,510 A380V probably damaging Het
Herc1 G T 9: 66,471,908 W3492L probably damaging Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Jag2 T A 12: 112,920,122 K246N probably damaging Het
Klhl32 T C 4: 24,629,195 D524G probably null Het
Lax1 A G 1: 133,680,596 S136P possibly damaging Het
Lefty1 A G 1: 180,937,160 K217E probably benign Het
Lgr5 A G 10: 115,478,525 L169P probably damaging Het
Mad1l1 A T 5: 140,315,055 S29T possibly damaging Het
Man1a T C 10: 54,074,795 H77R probably benign Het
Met C T 6: 17,558,733 S1120F probably damaging Het
Mfsd4b2 A T 10: 39,921,609 I250N probably damaging Het
Myod1 A G 7: 46,376,881 H70R possibly damaging Het
Neb T C 2: 52,212,692 N4280S probably benign Het
Nudt6 T C 3: 37,419,489 T28A possibly damaging Het
Nup85 A G 11: 115,583,734 E628G probably damaging Het
Oaz3 A T 3: 94,434,988 D120E probably damaging Het
Olfr1031 C A 2: 85,991,941 N41K probably damaging Het
Olfr131 A T 17: 38,082,729 M83K probably damaging Het
Olfr1454 A T 19: 13,063,345 probably benign Het
Olfr786 A C 10: 129,436,943 I44L probably damaging Het
Osbpl8 A T 10: 111,273,068 K404* probably null Het
Pcdhga2 A G 18: 37,670,905 N601D probably damaging Het
Pld2 T C 11: 70,554,675 Y638H probably damaging Het
Prickle2 C G 6: 92,458,615 V2L possibly damaging Het
Psmd6 G A 14: 14,116,949 R125C probably benign Het
Rnaset2b G A 17: 6,991,694 V24I probably benign Het
Rusc2 A T 4: 43,416,416 D574V probably benign Het
Scn8a T A 15: 100,940,115 probably null Het
Sec11a T C 7: 80,923,131 E134G probably benign Het
Senp5 A G 16: 31,989,884 V157A probably damaging Het
Shkbp1 C T 7: 27,351,695 probably null Het
Slc43a1 T C 2: 84,859,784 L435P probably damaging Het
Spn G A 7: 127,136,723 P204L possibly damaging Het
Srr T A 11: 74,910,202 Q173L probably damaging Het
Star C G 8: 25,811,807 T222S probably benign Het
Timm22 T A 11: 76,411,127 Y93N probably damaging Het
Tmc4 G T 7: 3,675,459 Q58K probably benign Het
Tmem86b C T 7: 4,629,836 M1I probably null Het
Tmtc2 A T 10: 105,369,970 I488N probably damaging Het
Tnxb A T 17: 34,694,388 Y1792F probably damaging Het
Tph1 T A 7: 46,647,443 R443W possibly damaging Het
Ttyh1 T A 7: 4,129,324 V253E possibly damaging Het
Usf3 A G 16: 44,218,577 D1140G probably benign Het
Usp10 T C 8: 119,941,316 S118P probably benign Het
Vmn2r63 C T 7: 42,903,297 C845Y probably benign Het
Vmn2r72 G T 7: 85,751,174 F222L probably damaging Het
Zfp654 G A 16: 64,786,094 Q582* probably null Het
Zfp791 C T 8: 85,119,650 probably benign Het
Zfp879 T A 11: 50,838,475 D32V probably damaging Het
Other mutations in Olfr1105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01673:Olfr1105 APN 2 87033387 missense probably damaging 1.00
IGL02029:Olfr1105 APN 2 87033901 missense probably benign 0.00
IGL02332:Olfr1105 APN 2 87034212 missense probably benign 0.32
3-1:Olfr1105 UTSW 2 87033684 missense probably damaging 1.00
R0060:Olfr1105 UTSW 2 87033774 missense probably damaging 1.00
R0060:Olfr1105 UTSW 2 87033774 missense probably damaging 1.00
R0100:Olfr1105 UTSW 2 87033595 missense probably benign 0.01
R0100:Olfr1105 UTSW 2 87033595 missense probably benign 0.01
R0417:Olfr1105 UTSW 2 87033445 missense probably damaging 0.99
R0573:Olfr1105 UTSW 2 87033468 missense probably damaging 1.00
R0589:Olfr1105 UTSW 2 87034115 nonsense probably null
R0630:Olfr1105 UTSW 2 87033309 missense probably benign 0.05
R0690:Olfr1105 UTSW 2 87033882 missense probably damaging 1.00
R3929:Olfr1105 UTSW 2 87034084 missense possibly damaging 0.88
R4563:Olfr1105 UTSW 2 87033684 missense probably damaging 1.00
R4718:Olfr1105 UTSW 2 87033895 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAATACTTGAAACACTGCAGG -3'
(R):5'- GGAACAGTGATATCAACTTACCTG -3'

Sequencing Primer
(F):5'- AGCTTATGCCTTTAATCCCAGCAC -3'
(R):5'- CAGTGATATCAACTTACCTGGGAAC -3'
Posted On2018-04-27