Incidental Mutation 'R6362:Daxx'
ID512553
Institutional Source Beutler Lab
Gene Symbol Daxx
Ensembl Gene ENSMUSG00000002307
Gene NameFas death domain-associated protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6362 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location33909414-33915589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33911364 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 118 (V118I)
Ref Sequence ENSEMBL: ENSMUSP00000133319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053429] [ENSMUST00000079421] [ENSMUST00000170075] [ENSMUST00000172619] [ENSMUST00000172817] [ENSMUST00000173028] [ENSMUST00000173626] [ENSMUST00000174146] [ENSMUST00000174463] [ENSMUST00000174541]
Predicted Effect probably benign
Transcript: ENSMUST00000053429
SMART Domains Protein: ENSMUSP00000057466
Gene: ENSMUSG00000051390

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
BTB 57 151 7.21e-22 SMART
low complexity region 152 176 N/A INTRINSIC
low complexity region 317 355 N/A INTRINSIC
low complexity region 390 403 N/A INTRINSIC
low complexity region 431 443 N/A INTRINSIC
low complexity region 460 479 N/A INTRINSIC
ZnF_C2H2 483 504 1.24e2 SMART
ZnF_C2H2 510 532 1.28e-3 SMART
ZnF_C2H2 538 559 4.69e0 SMART
low complexity region 567 587 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079421
AA Change: V118I

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078390
Gene: ENSMUSG00000002307
AA Change: V118I

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Daxx 54 152 1.3e-51 PFAM
Blast:KISc 185 261 2e-17 BLAST
PDB:4H9S|F 189 404 1e-131 PDB
SCOP:d1sig__ 437 493 7e-3 SMART
low complexity region 573 584 N/A INTRINSIC
low complexity region 693 715 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170075
AA Change: V118I

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128504
Gene: ENSMUSG00000002307
AA Change: V118I

DomainStartEndE-ValueType
Pfam:Daxx 1 740 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172526
Predicted Effect probably benign
Transcript: ENSMUST00000172619
SMART Domains Protein: ENSMUSP00000134695
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
PDB:3F8U|D 12 119 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000172817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172859
Predicted Effect probably damaging
Transcript: ENSMUST00000173028
AA Change: V118I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133319
Gene: ENSMUSG00000002307
AA Change: V118I

DomainStartEndE-ValueType
Pfam:Daxx 1 137 1.6e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173279
Predicted Effect probably damaging
Transcript: ENSMUST00000173626
AA Change: V118I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133303
Gene: ENSMUSG00000002307
AA Change: V118I

DomainStartEndE-ValueType
Pfam:Daxx 1 167 6.8e-74 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174146
AA Change: V118I

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134158
Gene: ENSMUSG00000002307
AA Change: V118I

DomainStartEndE-ValueType
Pfam:Daxx 1 740 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174321
Predicted Effect probably benign
Transcript: ENSMUST00000174463
SMART Domains Protein: ENSMUSP00000133345
Gene: ENSMUSG00000051390

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
Pfam:BTB 47 87 7.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174467
Predicted Effect possibly damaging
Transcript: ENSMUST00000174541
AA Change: V118I

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133552
Gene: ENSMUSG00000002307
AA Change: V118I

DomainStartEndE-ValueType
Pfam:Daxx 1 702 1.5e-297 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174646
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multifunctional protein that resides in multiple locations in the nucleus and in the cytoplasm. It interacts with a wide variety of proteins, such as apoptosis antigen Fas, centromere protein C, and transcription factor erythroblastosis virus E26 oncogene homolog 1. In the nucleus, the encoded protein functions as a potent transcription repressor that binds to sumoylated transcription factors. Its repression can be relieved by the sequestration of this protein into promyelocytic leukemia nuclear bodies or nucleoli. This protein also associates with centromeres in G2 phase. In the cytoplasm, the encoded protein may function to regulate apoptosis. The subcellular localization and function of this protein are modulated by post-translational modifications, including sumoylation, phosphorylation and polyubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene display extensive apoptosis and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T G 2: 173,528,174 probably null Het
Aldh5a1 T G 13: 24,918,550 D310A probably benign Het
Als2cl T A 9: 110,895,446 probably null Het
Amacr C A 15: 10,984,805 R170S probably damaging Het
Brwd1 C T 16: 96,002,307 R2221Q probably damaging Het
Cacna1g A T 11: 94,439,707 probably null Het
Cd3d G A 9: 44,986,291 D157N probably damaging Het
Cep131 T C 11: 120,064,690 D1043G probably damaging Het
Cit A G 5: 115,886,676 D326G probably benign Het
Col16a1 G C 4: 130,066,190 G370R unknown Het
Col6a3 T A 1: 90,810,563 Y1078F probably damaging Het
Colgalt2 A C 1: 152,471,798 Y161S probably damaging Het
Cyp2j13 A G 4: 96,071,695 Y75H probably damaging Het
Dennd5a G T 7: 109,934,265 C75* probably null Het
Diaph3 A G 14: 86,772,130 L1071P probably damaging Het
Disp3 A G 4: 148,254,308 L802P possibly damaging Het
Dmc1 A G 15: 79,588,823 V141A probably benign Het
Dsc2 A T 18: 20,035,463 Y45* probably null Het
Dspp A G 5: 104,176,034 I348V probably benign Het
Epb42 C A 2: 121,025,779 C428F possibly damaging Het
Fam227a G T 15: 79,643,350 P100Q possibly damaging Het
Fer1l4 C T 2: 156,048,250 V252I probably benign Het
Fhod1 C A 8: 105,331,641 probably null Het
Fhod3 G T 18: 24,754,255 A68S probably benign Het
Gatm T C 2: 122,598,196 D328G probably benign Het
Gm13103 A G 4: 143,852,865 Y340C probably damaging Het
Gm6401 G T 14: 41,967,770 H44N probably benign Het
Gm884 G C 11: 103,620,652 N163K unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpr84 G A 15: 103,308,510 A380V probably damaging Het
Herc1 G T 9: 66,471,908 W3492L probably damaging Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Jag2 T A 12: 112,920,122 K246N probably damaging Het
Klhl32 T C 4: 24,629,195 D524G probably null Het
Lax1 A G 1: 133,680,596 S136P possibly damaging Het
Lefty1 A G 1: 180,937,160 K217E probably benign Het
Lgr5 A G 10: 115,478,525 L169P probably damaging Het
Mad1l1 A T 5: 140,315,055 S29T possibly damaging Het
Man1a T C 10: 54,074,795 H77R probably benign Het
Met C T 6: 17,558,733 S1120F probably damaging Het
Mfsd4b2 A T 10: 39,921,609 I250N probably damaging Het
Myod1 A G 7: 46,376,881 H70R possibly damaging Het
Neb T C 2: 52,212,692 N4280S probably benign Het
Nudt6 T C 3: 37,419,489 T28A possibly damaging Het
Nup85 A G 11: 115,583,734 E628G probably damaging Het
Oaz3 A T 3: 94,434,988 D120E probably damaging Het
Olfr1031 C A 2: 85,991,941 N41K probably damaging Het
Olfr1105 C T 2: 87,033,289 A311T probably benign Het
Olfr131 A T 17: 38,082,729 M83K probably damaging Het
Olfr1454 A T 19: 13,063,345 probably benign Het
Olfr786 A C 10: 129,436,943 I44L probably damaging Het
Osbpl8 A T 10: 111,273,068 K404* probably null Het
Pcdhga2 A G 18: 37,670,905 N601D probably damaging Het
Pld2 T C 11: 70,554,675 Y638H probably damaging Het
Prickle2 C G 6: 92,458,615 V2L possibly damaging Het
Psmd6 G A 14: 14,116,949 R125C probably benign Het
Rnaset2b G A 17: 6,991,694 V24I probably benign Het
Rusc2 A T 4: 43,416,416 D574V probably benign Het
Scn8a T A 15: 100,940,115 probably null Het
Sec11a T C 7: 80,923,131 E134G probably benign Het
Senp5 A G 16: 31,989,884 V157A probably damaging Het
Shkbp1 C T 7: 27,351,695 probably null Het
Slc43a1 T C 2: 84,859,784 L435P probably damaging Het
Spn G A 7: 127,136,723 P204L possibly damaging Het
Srr T A 11: 74,910,202 Q173L probably damaging Het
Star C G 8: 25,811,807 T222S probably benign Het
Timm22 T A 11: 76,411,127 Y93N probably damaging Het
Tmc4 G T 7: 3,675,459 Q58K probably benign Het
Tmem86b C T 7: 4,629,836 M1I probably null Het
Tmtc2 A T 10: 105,369,970 I488N probably damaging Het
Tnxb A T 17: 34,694,388 Y1792F probably damaging Het
Tph1 T A 7: 46,647,443 R443W possibly damaging Het
Ttyh1 T A 7: 4,129,324 V253E possibly damaging Het
Usf3 A G 16: 44,218,577 D1140G probably benign Het
Usp10 T C 8: 119,941,316 S118P probably benign Het
Vmn2r63 C T 7: 42,903,297 C845Y probably benign Het
Vmn2r72 G T 7: 85,751,174 F222L probably damaging Het
Zfp654 G A 16: 64,786,094 Q582* probably null Het
Zfp791 C T 8: 85,119,650 probably benign Het
Zfp879 T A 11: 50,838,475 D32V probably damaging Het
Other mutations in Daxx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Daxx APN 17 33911607 nonsense probably null
IGL01066:Daxx APN 17 33913893 missense probably benign 0.43
IGL01622:Daxx APN 17 33913480 missense probably benign
IGL02245:Daxx APN 17 33912377 splice site probably benign
IGL02432:Daxx APN 17 33912337 missense probably benign 0.31
IGL02484:Daxx APN 17 33912242 missense probably damaging 1.00
IGL02992:Daxx APN 17 33911748 missense probably damaging 1.00
R0302:Daxx UTSW 17 33913620 missense probably damaging 1.00
R0356:Daxx UTSW 17 33913893 missense probably benign 0.43
R0437:Daxx UTSW 17 33913624 missense probably benign 0.00
R0635:Daxx UTSW 17 33912644 missense probably benign 0.00
R0932:Daxx UTSW 17 33910661 missense probably damaging 1.00
R1498:Daxx UTSW 17 33912253 missense probably damaging 1.00
R1785:Daxx UTSW 17 33911842 missense probably damaging 1.00
R1996:Daxx UTSW 17 33913611 missense possibly damaging 0.89
R2367:Daxx UTSW 17 33911847 missense probably benign 0.38
R4320:Daxx UTSW 17 33911419 missense probably damaging 1.00
R4321:Daxx UTSW 17 33911406 missense possibly damaging 0.94
R5055:Daxx UTSW 17 33912160 missense probably benign 0.01
R5546:Daxx UTSW 17 33912641 small deletion probably benign
R5547:Daxx UTSW 17 33912641 small deletion probably benign
R5547:Daxx UTSW 17 33912659 small deletion probably benign
R5591:Daxx UTSW 17 33911688 missense probably damaging 1.00
R6317:Daxx UTSW 17 33911975 missense probably damaging 1.00
R6493:Daxx UTSW 17 33912371 critical splice donor site probably null
R7100:Daxx UTSW 17 33911442 missense probably damaging 1.00
R7176:Daxx UTSW 17 33913318 missense unknown
R7310:Daxx UTSW 17 33910461 missense possibly damaging 0.70
R7418:Daxx UTSW 17 33910605 missense probably benign 0.05
R7476:Daxx UTSW 17 33911281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTATGGTGTGATAGGGC -3'
(R):5'- CCTCAGAGGCAGTGTTTTCAG -3'

Sequencing Primer
(F):5'- CACTATGGTGTGATAGGGCCGATG -3'
(R):5'- CAGTGTTTGTAAGGTCAGAGGG -3'
Posted On2018-04-27