Incidental Mutation 'R6365:Hibch'
List |< first << previous [record 91 of 217] next >> last >|
ID512613
Institutional Source Beutler Lab
Gene Symbol Hibch
Ensembl Gene ENSMUSG00000041426
Gene Name3-hydroxyisobutyryl-Coenzyme A hydrolase
Synonyms2610509I15Rik, HIBYL-COA-H
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R6365 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location52844929-52920986 bp(+) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) T to A at 52868937 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044478] [ENSMUST00000159352]
Predicted Effect probably null
Transcript: ENSMUST00000044478
SMART Domains Protein: ENSMUSP00000045606
Gene: ENSMUSG00000041426

DomainStartEndE-ValueType
Pfam:ECH_1 43 282 6.6e-34 PFAM
Pfam:ECH_2 45 375 3.9e-141 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159352
SMART Domains Protein: ENSMUSP00000124976
Gene: ENSMUSG00000041426

DomainStartEndE-ValueType
Pfam:ECH 44 299 1.3e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162523
Meta Mutation Damage Score 0.652 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for hydrolysis of both HIBYL-CoA and beta-hydroxypropionyl-CoA. Mutations in this gene have been associated with 3-hyroxyisobutyryl-CoA hydrolase deficiency. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,182,644 R1235S probably benign Het
Abca9 T A 11: 110,145,655 I543F possibly damaging Het
Acot6 A G 12: 84,109,412 E378G probably benign Het
Adam30 T C 3: 98,161,034 L61S probably damaging Het
Agap3 T A 5: 24,474,985 L227Q probably benign Het
Ap5m1 T C 14: 49,078,828 I285T probably benign Het
Atp2a2 A G 5: 122,461,916 Y497H probably benign Het
Bace1 C T 9: 45,854,676 Q17* probably null Het
Calcr T C 6: 3,711,455 I189V probably benign Het
Cd48 A T 1: 171,682,164 Q24L probably null Het
Cnga1 T C 5: 72,604,945 I409V probably benign Het
Ctsd G A 7: 142,385,577 T37M probably benign Het
Cyp2c29 T C 19: 39,307,754 S171P probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd2 A T 9: 49,406,949 N397I probably damaging Het
Dst A G 1: 34,191,927 E3045G probably damaging Het
Dzip3 T A 16: 48,931,273 R764S probably damaging Het
Exosc10 T C 4: 148,561,105 V114A probably benign Het
Fam234a C A 17: 26,220,455 E32* probably null Het
Fbxw11 C A 11: 32,720,623 D162E possibly damaging Het
Fcho2 A T 13: 98,789,859 M72K probably benign Het
Fech T C 18: 64,458,180 N391S probably benign Het
Foxp2 T C 6: 15,286,685 L58P probably damaging Het
Gdi2 A G 13: 3,565,093 D430G possibly damaging Het
Gm11639 A G 11: 104,924,586 E3247G unknown Het
Grm8 C T 6: 27,363,227 C763Y probably damaging Het
Hist1h2be C T 13: 23,585,658 R100H probably benign Het
Ifi44l C T 3: 151,761,505 V63I unknown Het
Igf1r G T 7: 68,190,050 A702S probably benign Het
Kctd13 G A 7: 126,930,690 R101Q probably damaging Het
Klhl33 T C 14: 50,891,837 D645G probably benign Het
Lrrc6 A T 15: 66,454,134 S197R probably benign Het
Mylk A G 16: 34,860,591 T74A probably benign Het
Myo1f A G 17: 33,586,116 S453G probably benign Het
Naxe A G 3: 88,057,991 V105A probably damaging Het
Nid2 A G 14: 19,803,133 Y1140C probably damaging Het
Nlrp12 T C 7: 3,239,888 T665A probably benign Het
Olfr630 T A 7: 103,755,195 H130L probably benign Het
Otud7b T G 3: 96,155,250 I602S probably benign Het
Palm2 G T 4: 57,709,675 G207* probably null Het
Papolg T C 11: 23,882,290 D166G probably damaging Het
Pbx4 T G 8: 69,872,207 probably null Het
Pdcd4 T C 19: 53,922,133 probably null Het
Pde2a C T 7: 101,510,363 T800I probably damaging Het
Polk A T 13: 96,484,009 V582E probably damaging Het
Prss40 A G 1: 34,552,517 probably benign Het
Robo4 G T 9: 37,410,712 R597L probably benign Het
Scg2 T A 1: 79,435,300 I529F probably benign Het
Sema7a T C 9: 57,954,905 F180L probably benign Het
Sowahc T C 10: 59,223,527 L495P probably damaging Het
Trf A G 9: 103,222,128 V324A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vip C T 10: 5,644,021 R125* probably null Het
Vmn1r159 T A 7: 22,843,401 T69S probably damaging Het
Vmn1r202 A T 13: 22,502,204 F14L probably benign Het
Vmn1r53 T C 6: 90,224,259 N28D probably damaging Het
Vmn2r58 T A 7: 41,864,183 K345N probably benign Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb8os A T 4: 129,343,152 N120I possibly damaging Het
Zfp959 T A 17: 55,897,785 L274H probably damaging Het
Other mutations in Hibch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Hibch APN 1 52885190 splice site probably benign
IGL00722:Hibch APN 1 52901320 missense probably damaging 0.96
IGL03130:Hibch APN 1 52885151 missense possibly damaging 0.88
IGL03327:Hibch APN 1 52920380 unclassified probably benign
IGL03346:Hibch APN 1 52920380 unclassified probably benign
R0033:Hibch UTSW 1 52905451 missense probably null 0.60
R0033:Hibch UTSW 1 52905451 missense probably null 0.60
R0494:Hibch UTSW 1 52902896 missense possibly damaging 0.73
R1853:Hibch UTSW 1 52901335 critical splice donor site probably null
R4838:Hibch UTSW 1 52885178 missense possibly damaging 0.55
R5239:Hibch UTSW 1 52865608 missense probably damaging 1.00
R5531:Hibch UTSW 1 52845069 utr 5 prime probably benign
R5583:Hibch UTSW 1 52901247 missense probably damaging 1.00
R5809:Hibch UTSW 1 52853700 missense probably benign 0.16
R6246:Hibch UTSW 1 52904642 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTAACGCACAGCTGGGTATGTG -3'
(R):5'- TGGGTTAAAGAATCTAAAGTGCTCC -3'

Sequencing Primer
(F):5'- CACAGCTGGGTATGTGGCCTATAAG -3'
(R):5'- AAGTGCTCCAATACAATTTATATCCC -3'
Posted On2018-04-27