Incidental Mutation 'R6365:Palm2'
ID512621
Institutional Source Beutler Lab
Gene Symbol Palm2
Ensembl Gene ENSMUSG00000090053
Gene Nameparalemmin 2
Synonyms53-H12, pEN70
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R6365 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location57434247-57712016 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 57709675 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 207 (G207*)
Ref Sequence ENSEMBL: ENSMUSP00000099969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098066] [ENSMUST00000102904] [ENSMUST00000102905] [ENSMUST00000126465] [ENSMUST00000142556]
Predicted Effect probably benign
Transcript: ENSMUST00000098066
SMART Domains Protein: ENSMUSP00000095674
Gene: ENSMUSG00000089945

DomainStartEndE-ValueType
Pfam:Paralemmin 67 138 6.3e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102904
AA Change: G207*
SMART Domains Protein: ENSMUSP00000099968
Gene: ENSMUSG00000090053
AA Change: G207*

DomainStartEndE-ValueType
Pfam:Paralemmin 66 376 8e-55 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102905
AA Change: G207*
SMART Domains Protein: ENSMUSP00000099969
Gene: ENSMUSG00000090053
AA Change: G207*

DomainStartEndE-ValueType
Pfam:Paralemmin 67 376 5.8e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126465
SMART Domains Protein: ENSMUSP00000130230
Gene: ENSMUSG00000089945

DomainStartEndE-ValueType
Pfam:Paralemmin 67 138 6.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131201
Predicted Effect probably benign
Transcript: ENSMUST00000142556
SMART Domains Protein: ENSMUSP00000129817
Gene: ENSMUSG00000090053

DomainStartEndE-ValueType
Pfam:Paralemmin 66 136 8.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150412
SMART Domains Protein: ENSMUSP00000117466
Gene: ENSMUSG00000089945

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
low complexity region 35 59 N/A INTRINSIC
Pfam:Paralemmin 115 269 6.5e-23 PFAM
low complexity region 396 407 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
coiled coil region 499 557 N/A INTRINSIC
Pfam:AKAP2_C 847 1129 1.9e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,182,644 R1235S probably benign Het
Abca9 T A 11: 110,145,655 I543F possibly damaging Het
Acot6 A G 12: 84,109,412 E378G probably benign Het
Adam30 T C 3: 98,161,034 L61S probably damaging Het
Agap3 T A 5: 24,474,985 L227Q probably benign Het
Ap5m1 T C 14: 49,078,828 I285T probably benign Het
Atp2a2 A G 5: 122,461,916 Y497H probably benign Het
Bace1 C T 9: 45,854,676 Q17* probably null Het
Calcr T C 6: 3,711,455 I189V probably benign Het
Cd48 A T 1: 171,682,164 Q24L probably null Het
Cnga1 T C 5: 72,604,945 I409V probably benign Het
Ctsd G A 7: 142,385,577 T37M probably benign Het
Cyp2c29 T C 19: 39,307,754 S171P probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd2 A T 9: 49,406,949 N397I probably damaging Het
Dst A G 1: 34,191,927 E3045G probably damaging Het
Dzip3 T A 16: 48,931,273 R764S probably damaging Het
Exosc10 T C 4: 148,561,105 V114A probably benign Het
Fam234a C A 17: 26,220,455 E32* probably null Het
Fbxw11 C A 11: 32,720,623 D162E possibly damaging Het
Fcho2 A T 13: 98,789,859 M72K probably benign Het
Fech T C 18: 64,458,180 N391S probably benign Het
Foxp2 T C 6: 15,286,685 L58P probably damaging Het
Gdi2 A G 13: 3,565,093 D430G possibly damaging Het
Gm11639 A G 11: 104,924,586 E3247G unknown Het
Grm8 C T 6: 27,363,227 C763Y probably damaging Het
Hibch T A 1: 52,868,937 probably null Het
Hist1h2be C T 13: 23,585,658 R100H probably benign Het
Ifi44l C T 3: 151,761,505 V63I unknown Het
Igf1r G T 7: 68,190,050 A702S probably benign Het
Kctd13 G A 7: 126,930,690 R101Q probably damaging Het
Klhl33 T C 14: 50,891,837 D645G probably benign Het
Lrrc6 A T 15: 66,454,134 S197R probably benign Het
Mylk A G 16: 34,860,591 T74A probably benign Het
Myo1f A G 17: 33,586,116 S453G probably benign Het
Naxe A G 3: 88,057,991 V105A probably damaging Het
Nid2 A G 14: 19,803,133 Y1140C probably damaging Het
Nlrp12 T C 7: 3,239,888 T665A probably benign Het
Olfr630 T A 7: 103,755,195 H130L probably benign Het
Otud7b T G 3: 96,155,250 I602S probably benign Het
Papolg T C 11: 23,882,290 D166G probably damaging Het
Pbx4 T G 8: 69,872,207 probably null Het
Pdcd4 T C 19: 53,922,133 probably null Het
Pde2a C T 7: 101,510,363 T800I probably damaging Het
Polk A T 13: 96,484,009 V582E probably damaging Het
Prss40 A G 1: 34,552,517 probably benign Het
Robo4 G T 9: 37,410,712 R597L probably benign Het
Scg2 T A 1: 79,435,300 I529F probably benign Het
Sema7a T C 9: 57,954,905 F180L probably benign Het
Sowahc T C 10: 59,223,527 L495P probably damaging Het
Trf A G 9: 103,222,128 V324A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vip C T 10: 5,644,021 R125* probably null Het
Vmn1r159 T A 7: 22,843,401 T69S probably damaging Het
Vmn1r202 A T 13: 22,502,204 F14L probably benign Het
Vmn1r53 T C 6: 90,224,259 N28D probably damaging Het
Vmn2r58 T A 7: 41,864,183 K345N probably benign Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb8os A T 4: 129,343,152 N120I possibly damaging Het
Zfp959 T A 17: 55,897,785 L274H probably damaging Het
Other mutations in Palm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02736:Palm2 APN 4 57709721 missense probably damaging 0.96
PIT4305001:Palm2 UTSW 4 57638029 missense possibly damaging 0.94
R0158:Palm2 UTSW 4 57709649 missense possibly damaging 0.96
R0244:Palm2 UTSW 4 57710177 missense possibly damaging 0.74
R0763:Palm2 UTSW 4 57688441 missense probably damaging 1.00
R0800:Palm2 UTSW 4 57709650 missense probably benign 0.06
R1861:Palm2 UTSW 4 57709468 missense probably damaging 0.97
R1895:Palm2 UTSW 4 57638068 missense probably benign 0.01
R4600:Palm2 UTSW 4 57709954 missense probably benign 0.26
R6320:Palm2 UTSW 4 57710173 missense probably damaging 1.00
R6983:Palm2 UTSW 4 57709973 missense probably damaging 1.00
R7090:Palm2 UTSW 4 57648042 missense probably benign 0.00
X0065:Palm2 UTSW 4 57709805 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACCAAGATTCTCTCTGCATCCAC -3'
(R):5'- CCTCGATGTTTTGGTAGCCC -3'

Sequencing Primer
(F):5'- ATCCACCATTGGCCCAGAGG -3'
(R):5'- GCCCATAAAAATCATGGTGACTG -3'
Posted On2018-04-27