Incidental Mutation 'R6365:Grm8'
ID512630
Institutional Source Beutler Lab
Gene Symbol Grm8
Ensembl Gene ENSMUSG00000024211
Gene Nameglutamate receptor, metabotropic 8
SynonymsmGluR8, Gprc1h
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6365 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location27275119-28135178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27363227 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 763 (C763Y)
Ref Sequence ENSEMBL: ENSMUSP00000110979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090512] [ENSMUST00000115323] [ENSMUST00000115324]
Predicted Effect probably damaging
Transcript: ENSMUST00000090512
AA Change: C763Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087998
Gene: ENSMUSG00000024211
AA Change: C763Y

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 9.6e-102 PFAM
Pfam:Peripla_BP_6 141 375 1.3e-9 PFAM
Pfam:NCD3G 512 562 5e-17 PFAM
Pfam:7tm_3 593 841 4.7e-88 PFAM
low complexity region 887 905 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115323
AA Change: C763Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110978
Gene: ENSMUSG00000024211
AA Change: C763Y

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 3.3e-107 PFAM
Pfam:NCD3G 512 562 9e-14 PFAM
Pfam:7tm_3 595 840 6.8e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115324
AA Change: C763Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110979
Gene: ENSMUSG00000024211
AA Change: C763Y

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 2.1e-101 PFAM
Pfam:Peripla_BP_6 141 375 9.2e-10 PFAM
Pfam:NCD3G 512 562 2.8e-16 PFAM
Pfam:7tm_3 593 841 2.4e-87 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overweight and mildly insulin resistant, and display increased anxiety-related responses and reduced exploration in a new environment. Mice homozygous for a different knock-out allele exhibit altered excitatory responses in the dentate gyrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,182,644 R1235S probably benign Het
Abca9 T A 11: 110,145,655 I543F possibly damaging Het
Acot6 A G 12: 84,109,412 E378G probably benign Het
Adam30 T C 3: 98,161,034 L61S probably damaging Het
Agap3 T A 5: 24,474,985 L227Q probably benign Het
Ap5m1 T C 14: 49,078,828 I285T probably benign Het
Atp2a2 A G 5: 122,461,916 Y497H probably benign Het
Bace1 C T 9: 45,854,676 Q17* probably null Het
Calcr T C 6: 3,711,455 I189V probably benign Het
Cd48 A T 1: 171,682,164 Q24L probably null Het
Cnga1 T C 5: 72,604,945 I409V probably benign Het
Ctsd G A 7: 142,385,577 T37M probably benign Het
Cyp2c29 T C 19: 39,307,754 S171P probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd2 A T 9: 49,406,949 N397I probably damaging Het
Dst A G 1: 34,191,927 E3045G probably damaging Het
Dzip3 T A 16: 48,931,273 R764S probably damaging Het
Exosc10 T C 4: 148,561,105 V114A probably benign Het
Fam234a C A 17: 26,220,455 E32* probably null Het
Fbxw11 C A 11: 32,720,623 D162E possibly damaging Het
Fcho2 A T 13: 98,789,859 M72K probably benign Het
Fech T C 18: 64,458,180 N391S probably benign Het
Foxp2 T C 6: 15,286,685 L58P probably damaging Het
Gdi2 A G 13: 3,565,093 D430G possibly damaging Het
Gm11639 A G 11: 104,924,586 E3247G unknown Het
Hibch T A 1: 52,868,937 probably null Het
Hist1h2be C T 13: 23,585,658 R100H probably benign Het
Ifi44l C T 3: 151,761,505 V63I unknown Het
Igf1r G T 7: 68,190,050 A702S probably benign Het
Kctd13 G A 7: 126,930,690 R101Q probably damaging Het
Klhl33 T C 14: 50,891,837 D645G probably benign Het
Lrrc6 A T 15: 66,454,134 S197R probably benign Het
Mylk A G 16: 34,860,591 T74A probably benign Het
Myo1f A G 17: 33,586,116 S453G probably benign Het
Naxe A G 3: 88,057,991 V105A probably damaging Het
Nid2 A G 14: 19,803,133 Y1140C probably damaging Het
Nlrp12 T C 7: 3,239,888 T665A probably benign Het
Olfr630 T A 7: 103,755,195 H130L probably benign Het
Otud7b T G 3: 96,155,250 I602S probably benign Het
Palm2 G T 4: 57,709,675 G207* probably null Het
Papolg T C 11: 23,882,290 D166G probably damaging Het
Pbx4 T G 8: 69,872,207 probably null Het
Pdcd4 T C 19: 53,922,133 probably null Het
Pde2a C T 7: 101,510,363 T800I probably damaging Het
Polk A T 13: 96,484,009 V582E probably damaging Het
Prss40 A G 1: 34,552,517 probably benign Het
Robo4 G T 9: 37,410,712 R597L probably benign Het
Scg2 T A 1: 79,435,300 I529F probably benign Het
Sema7a T C 9: 57,954,905 F180L probably benign Het
Sowahc T C 10: 59,223,527 L495P probably damaging Het
Trf A G 9: 103,222,128 V324A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vip C T 10: 5,644,021 R125* probably null Het
Vmn1r159 T A 7: 22,843,401 T69S probably damaging Het
Vmn1r202 A T 13: 22,502,204 F14L probably benign Het
Vmn1r53 T C 6: 90,224,259 N28D probably damaging Het
Vmn2r58 T A 7: 41,864,183 K345N probably benign Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb8os A T 4: 129,343,152 N120I possibly damaging Het
Zfp959 T A 17: 55,897,785 L274H probably damaging Het
Other mutations in Grm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Grm8 APN 6 27363801 missense probably damaging 1.00
IGL01412:Grm8 APN 6 27762461 missense probably damaging 1.00
IGL02329:Grm8 APN 6 27363116 missense probably damaging 1.00
IGL02342:Grm8 APN 6 27363804 missense probably benign 0.00
IGL02584:Grm8 APN 6 27762439 missense probably benign 0.35
IGL03040:Grm8 APN 6 28126123 start codon destroyed probably null 0.01
IGL03112:Grm8 APN 6 27363263 missense probably damaging 1.00
IGL03139:Grm8 APN 6 27618650 missense probably damaging 1.00
IGL03287:Grm8 APN 6 27760255 missense possibly damaging 0.86
R0137:Grm8 UTSW 6 27762390 missense probably damaging 0.99
R0266:Grm8 UTSW 6 27285896 missense probably damaging 1.00
R0347:Grm8 UTSW 6 27981222 missense probably benign 0.37
R0580:Grm8 UTSW 6 27761371 splice site probably benign
R0698:Grm8 UTSW 6 27363914 missense probably damaging 1.00
R0833:Grm8 UTSW 6 27363179 missense probably damaging 1.00
R1301:Grm8 UTSW 6 27981201 missense possibly damaging 0.94
R1323:Grm8 UTSW 6 28125974 missense probably damaging 1.00
R1323:Grm8 UTSW 6 28125974 missense probably damaging 1.00
R1471:Grm8 UTSW 6 27363309 missense possibly damaging 0.79
R1554:Grm8 UTSW 6 28125853 missense probably benign 0.01
R1638:Grm8 UTSW 6 28125883 nonsense probably null
R1763:Grm8 UTSW 6 27285867 missense possibly damaging 0.79
R1899:Grm8 UTSW 6 28125895 missense probably damaging 1.00
R1902:Grm8 UTSW 6 27429482 missense probably damaging 1.00
R1916:Grm8 UTSW 6 27363584 missense probably benign 0.01
R2257:Grm8 UTSW 6 27760225 missense probably damaging 0.98
R2351:Grm8 UTSW 6 28126119 missense possibly damaging 0.66
R2396:Grm8 UTSW 6 27761242 missense probably damaging 0.98
R3801:Grm8 UTSW 6 28125636 missense possibly damaging 0.95
R3802:Grm8 UTSW 6 28125636 missense possibly damaging 0.95
R3803:Grm8 UTSW 6 28125636 missense possibly damaging 0.95
R3804:Grm8 UTSW 6 28125636 missense possibly damaging 0.95
R3830:Grm8 UTSW 6 27761229 nonsense probably null
R3844:Grm8 UTSW 6 27429508 missense possibly damaging 0.69
R4006:Grm8 UTSW 6 27981230 missense probably damaging 1.00
R4077:Grm8 UTSW 6 27760209 missense probably benign 0.01
R4395:Grm8 UTSW 6 27429432 missense probably damaging 0.98
R4436:Grm8 UTSW 6 27761238 missense possibly damaging 0.48
R4810:Grm8 UTSW 6 27761296 missense possibly damaging 0.87
R5357:Grm8 UTSW 6 27762419 missense probably damaging 1.00
R5677:Grm8 UTSW 6 27761204 critical splice donor site probably null
R5983:Grm8 UTSW 6 27760221 missense probably benign 0.03
R5990:Grm8 UTSW 6 27363624 missense probably damaging 1.00
R6454:Grm8 UTSW 6 27363776 missense possibly damaging 0.68
R6713:Grm8 UTSW 6 27363191 missense probably damaging 1.00
R6960:Grm8 UTSW 6 27981282 missense probably damaging 0.98
R7194:Grm8 UTSW 6 27618487 missense probably benign 0.01
R7259:Grm8 UTSW 6 27760176 missense probably null 0.99
R7305:Grm8 UTSW 6 27761355 missense possibly damaging 0.51
R7421:Grm8 UTSW 6 27762477 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AAGTTGTCAAACAGATTTCCTGCTG -3'
(R):5'- TAAGTTCATCAGCCCAGCATCC -3'

Sequencing Primer
(F):5'- AAACAGATTTCCTGCTGCTTAC -3'
(R):5'- AGCATCCCAGCTGGTGATCAC -3'
Posted On2018-04-27